| Primary information |
|---|
| SALID | SAL_24641 |
| Biomarker name | hsa-miR-4455 |
| Biomarker Type | Diagnostic |
| Sampling Method | Individuals of balanced constitution (group P), Yang deficiency constitution (group Ya) and Yin deficiency constitution (group Yi) were chosen using a standardized questionnaire. A total of 15 subjects were finally included, with 5 in each group. |
| Collection Method | Total-RNA extraction was performed with TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. |
| Analysis Method | Microarray |
| Collection Site | Saliva |
| Disease Category | Deficiency |
| Disease/Condition | Yin deficiency constitution |
| Disease Subtype | NA |
| Fold Change/ Concentration | 1.31 |
| Up/Downregulated | Upregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 30248664 |
| Year of Publication | 2018 |
| Biomarker ID | hsa-miR-4455 |
| Biomarker Category | miRNA |
| Sequence | AGAAGGGUGUGUGUGUUUUUCCUGAGAAUAAGAGAAGGAAGGACAGCCAAAUUCUUCA |
| Title of study | miRNA Expression Profile of Saliva in Subjects of Yang Deficiency Constitution and Yin Deficiency Constitution |
| Abstract of study | BACKGROUND/AIMS: Based on the theory of constitution in Traditional Chinese Medicine (TCM), the Chinese Han population has been classified into nine constitutions. Of these, Yang deficiency constitution mainly exhibit cold intolerance while Yin deficiency constitution mainly exhibit heat intolerance. Some studies have been carried out to explore the modern genetic and biological basis of such constitution classification, but more remains to be done. MicroRNA (miRNA) serves as post-transcriptional regulators of gene expression and may play a role in the classification process. Here, we examined miRNA expression profile of saliva to further improve the comprehensiveness of constitution classification.METHODS: Saliva was collected from Chinese Han individuals with Yang deficiency, Yin deficiency and Balanced constitutions (n=5 each), and miRNA expression profile was determined using the Human miRNA OneArray®v7. Based on 1.5 Fold change, means log2|Ratio|≥0.585 and P-value< 0.05, differentially expressed miRNA was screened. Target genes were predicted using DIANA-TarBasev7.0 and analysis of KEGG pathway was carried out using DIANA-mirPathv.3.RESULTS: We found that 81 and 98 differentially expressed miRNAs were screened in Yang deficiency and Yin deficiency constitution, respectively. Among them, 16 miRNAs were identical and the others were unique. In addition, the target genes that are regulated by the unique miRNAs were significantly enriched in 27 and 20 signaling pathways in Yang deficiency and Yin deficiency constitution, respectively. Thyroid hormone signaling pathway is present in both constitutions. These unique miRNAs that regulated target genes of thyroid hormone signaling pathway may be associated with cold intolerance or heat intolerance.CONCLUSION: The results of our study show that Yang deficiency and Yin deficiency constitutions exhibit systematic differences in miRNA expression profile. Moreover, the distinct characteristics of TCM constitution may be explained, in part, by differentially expressed miRNAs. |