| Primary information |
|---|
| SALID | SAL_24626 |
| Biomarker name | hsa-miR-18b-5p |
| Biomarker Type | Diagnostic |
| Sampling Method | Total of 35 HFMD suspected throat swab and saliva clinical samples were obtained from Kandang Kerbau (KK) Women's and Children's Hospital from August 2012 to February 2016. |
| Collection Method | MiRNA was extracted from 50ul of saliva using biofluid extraction kit (Exiqon, Inc.) |
| Analysis Method | qRT-PCR |
| Collection Site | Saliva |
| Disease Category | Viral Disease |
| Disease/Condition | Hand, Foot and Mouth Disease (HFMD) |
| Disease Subtype | NA |
| Fold Change/ Concentration | NA |
| Up/Downregulated | NA |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 29754884 |
| Year of Publication | 2018 |
| Biomarker ID | hsa-miR-18b-5p |
| Biomarker Category | miRNA |
| Sequence | UAAGGUGCAUCUAGUGCAGUUAG |
| Title of study | Circulating Salivary miRNA hsa-miR-221 as Clinically Validated Diagnostic Marker for Hand, Foot, and Mouth Disease in Pediatric Patients |
| Abstract of study | Enhancements in the diagnostic capabilities using host biomarkers are currently much needed where sensitivity and specificity issues plague the diagnosis of Hand, Foot and Mouth Disease (HFMD) in pediatrics clinical samples. We investigated miRNome profiles of HFMD saliva samples against healthy children and developed miRNA-based diagnosis models. Our 6-miRNA scoring model predicted HFMD with an overall accuracy of 85.11% in the training set and 92.86% in the blinded test set of Singapore cohort. Blinded evaluation of the model in Taiwan HFMD cases resulted in 77.08% accuracy with the 6-miRNA model and 68.75% with the 4-miRNA model. The strongest predictor of HFMD in all of the panels, hsa-miR-221 was found to be consistently and significantly downregulated in all of our HFMD cohorts. This is the first study to prove that HFMD infection could be diagnosed by circulating miRNAs in patient's saliva. Moreover, this study also serves as a stepping stone towards the future development of other infectious disease diagnosis workflows using novel biomarkers. |