Primary information |
---|
SALID | SAL_24622 |
Biomarker name | hsa-let-7e |
Biomarker Type | Diagnostic |
Sampling Method | All 12 CLP patients were consecutively enrolled at the Orthodontics Clinic of the University of Campania ÒL. VanvitelliÓ from January 2015 to January 2016. |
Collection Method | Following the collection, saliva was processed as soon as possible, to avoid cell damage and subsequent miRNA release from exosomes in saliva. |
Analysis Method | RT-PCR |
Collection Site | Saliva |
Disease Category | Physical Deformity |
Disease/Condition | Cleft Lip and Palate (CLP) |
Disease Subtype | NA |
Fold Change/ Concentration | -1.83 |
Up/Downregulated | Downregulated |
Exosomal | Exosomal |
Organism | Homo sapiens |
PMID | 29721173 |
Year of Publication | 2018 |
Biomarker ID | hsa-let-7e |
Biomarker Category | miRNA |
Sequence | CCCGGGCUGAGGUAGGAGGUUGUAUAGUUGAGGAGGACACCCAAGGAGAUCACUAUACGGCCUCCUAGCUUUCCCCAGG |
Title of study | Salivary microRNAs as new molecular markers in cleft lip and palate: a new frontier in molecular medicine |
Abstract of study | MicroRNAs (miRNAs) are endogenous non-coding RNAs of about twenty-two nucleotides that regulate gene expression through post-transcriptional control. The purpose of the present study was to identify and describe the salivary miRNAs in cleft lip and palate (CLP) patients comparing them with a control healthy group. Twelve patients (mean age 11.9 ± 2.42 years; 6M/6F) formed the study group. The control group was created selecting twelve healthy subjects matched for age and sex with study group. We recorded differences in miRNA expression profile between the saliva of CLP patients and the control group. Specifically, miR-141, miR-223, and miR-324-3p were mostly deregulated between the study and control groups. Interestingly, these three miRNAs are the regulators of the following genes correlated to cleft palate and lip development: MTHFR, SATB2, PVRL1. The present study showed that collecting saliva samples is a non-invasive procedure and is well accepted by CLP patients. MiRNAs can be easily isolated and identified. The differences in regulation of miR-141, miR-223 and miR-324-3p between the two groups of salivary samples suggest that these molecules are valid prognostic biomarkers and therapy dynamic response indicators, also for the accuracy and non-invasive sampling and dosing system. |