Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_24616 details
Primary information
SALIDSAL_24616
Biomarker namehsa-miR-150
Biomarker TypeDiagnostic
Sampling MethodAll 12 CLP patients were consecutively enrolled at the Orthodontics Clinic of the University of Campania ÒL. VanvitelliÓ from January 2015 to January 2016.
Collection MethodFollowing the collection, saliva was processed as soon as possible, to avoid cell damage and subsequent miRNA release from exosomes in saliva.
Analysis MethodRT-PCR
Collection SiteSaliva
Disease CategoryPhysical Deformity
Disease/ConditionCleft Lip and Palate (CLP)
Disease SubtypeNA
Fold Change/ Concentration2.25
Up/DownregulatedUpregulated
ExosomalExosomal
OrganismHomo sapiens
PMID29721173
Year of Publication2018
Biomarker IDhsa-miR-150
Biomarker CategorymiRNA
SequenceCUCCCCAUGGCCCUGUCUCCCAACCCUUGUACCAGUGCUGGGCUCAGACCCUGGUACAGGCCUGGGGGACAGGGACCUGGGGAC
Title of studySalivary microRNAs as new molecular markers in cleft lip and palate: a new frontier in molecular medicine
Abstract of studyMicroRNAs (miRNAs) are endogenous non-coding RNAs of about twenty-two nucleotides that regulate gene expression through post-transcriptional control. The purpose of the present study was to identify and describe the salivary miRNAs in cleft lip and palate (CLP) patients comparing them with a control healthy group. Twelve patients (mean age 11.9 ± 2.42 years; 6M/6F) formed the study group. The control group was created selecting twelve healthy subjects matched for age and sex with study group. We recorded differences in miRNA expression profile between the saliva of CLP patients and the control group. Specifically, miR-141, miR-223, and miR-324-3p were mostly deregulated between the study and control groups. Interestingly, these three miRNAs are the regulators of the following genes correlated to cleft palate and lip development: MTHFR, SATB2, PVRL1. The present study showed that collecting saliva samples is a non-invasive procedure and is well accepted by CLP patients. MiRNAs can be easily isolated and identified. The differences in regulation of miR-141, miR-223 and miR-324-3p between the two groups of salivary samples suggest that these molecules are valid prognostic biomarkers and therapy dynamic response indicators, also for the accuracy and non-invasive sampling and dosing system.