| Primary information |
|---|
| SALID | SAL_24531 |
| Biomarker name | hsa-miR-137 |
| Biomarker Type | Diagnostic |
| Sampling Method | The subjects included (40) individuals divided into: (20) patients diagnosed with OLP and (20) healthy individuals (control group). |
| Collection Method | Whole unstimulated saliva (WUS) Spitting method was collected using standard technique. |
| Analysis Method | qRT-PCR |
| Collection Site | Saliva |
| Disease Category | Inflammatory Disorder |
| Disease/Condition | Oral Lichen Planus (OLP) |
| Disease Subtype | NA |
| Fold Change/ Concentration | 0.18 |
| Up/Downregulated | Downregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 29368136 |
| Year of Publication | 2018 |
| Biomarker ID | hsa-miR-137 |
| Biomarker Category | miRNA |
| Sequence | GGUCCUCUGACUCUCUUCGGUGACGGGUAUUCUUGGGUGGAUAAUACGGAUUACGUUGUUAUUGCUUAAGAAUACGCGUAGUCGAGGAGAGUACCAGCGGCA |
| Title of study | Evaluating the accuracy of microRNA27b and microRNA137 as biomarkers of activity and potential malignant transformation in oral lichen planus patients |
| Abstract of study | Oral lichen planus (OLP) is a chronic inflammatory mucocutaneous disease with a potential malignant transformation, characterized by cytotoxic T cells against basal epithelial cells. MicroRNAs (MiRNAs) are short non-coding RNA that plays critical role in gene expression at post-transcriptional levels. Much evidence showed that miRNAs play an important role in regulating immune response and cancer development. The purpose of the present study was to compare the expression of miRNA 27b and miRNA 137 in tissues and saliva between OLP patients and controls by using RT-qPCR and to evaluate their use as biomarkers of disease activity and potential malignant transformation. Our results showed down expression of miRNA 27b and miRNA 137 in tissue and saliva of OLP patients compared to controls; among OLP subgroups, erosive-type miRNA 137 revealed the lowest level in tissue and saliva. In conclusion, alteration of miRNA 27b and miRNA 137 gene expression signify their use as biomarkers for diseases activity and tendency of malignant transformation, and down expression of miRNA 137 especially in erosive-type favors the use of saliva sample as a noninvasive method for monitoring a potential malignant transformation of OLP. |