| Primary information |
|---|
| SALID | SAL_24528 |
| Biomarker name | hsa-miR-10b-5p |
| Biomarker Type | Diagnostic |
| Sampling Method | Validation of data on an independent set of saliva samples from an additional 11 cases and 9 cancer-free controls |
| Collection Method | Total RNA was extracted from each exosome pellet using the miRNeasy Micro kit (Qiagen, Valencia, CA) according to the manufacturer’s suggested protocol |
| Analysis Method | ddPCR |
| Collection Site | Saliva |
| Disease Category | Cancer |
| Disease/Condition | Head and Neck Cancer |
| Disease Subtype | Head and Neck Squamous Cell Carcinoma (HNSCC) |
| Fold Change/ Concentration | NA |
| Up/Downregulated | Upregulated |
| Exosomal | Exosomal |
| Organism | Homo sapiens |
| PMID | 29137278 |
| Year of Publication | 2018 |
| Biomarker ID | hsa-miR-10b-5p |
| Biomarker Category | miRNA |
| Sequence | UACCCUGUAGAACCGAAUUUGUG |
| Title of study | Comprehensive microRNA-sequencing of exosomes derived from head and neck carcinoma cells in vitro reveals common secretion profiles and potential utility as salivary biomarkers |
| Abstract of study | Exosomes are nano-scale, membrane encapsulated vesicles that are released by cells into the extracellular space and function as intercellular signaling vectors through horizontal transfer of biologic molecules, including microRNA (miRNA). There is evidence that cancer-derived exosomes enable the tumor to manipulate its microenvironment, thus contributing to the capacity of the tumor for immune evasion, growth, invasion, and metastatic spread. The objective of this study was to characterize differential secretion of exosomal miRNA by head and neck squamous cell carcinoma (HNSCC) and identify a set of candidate biomarkers that could be detected in non-invasive saliva samples. We isolated exosomes from conditioned media from 4 HNSCC cell lines and oral epithelial control cells and applied miRNA-sequencing to comprehensively characterize their miRNA cargo and compare transcript levels of each HNSCC cell line to that of oral epithelial control cells. A candidate set of miRNA differentially secreted by all 4 HNSCC cell lines was further evaluated in saliva collected from HNSCC patients and healthy controls. We observed extensive differences in exosomal miRNA content between HNSCC cells when compared to normal oral epithelial control cells, with a high degree of overlap in exosomal miRNA profiles between the 4 distinct HNSCC cell lines. Importantly, several of the exosomal miRNA secreted solely by cancer cells in culture were detected at substantially elevated levels in saliva from HNSCC patients relative to saliva from healthy controls. These findings provide important insight into tumor biology and yields a promising set of candidate HNSCC biomarkers for use with non-invasive saliva samples. |