Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_24526 details
Primary information
SALIDSAL_24526
Biomarker namehsa-miR-200a
Biomarker TypePrognostic
Sampling MethodBetween June 2002 and October 2006, 107 patients (90 male, 17 female, average age: 58 years) with squamous cell carcinoma of the head and neck were included in a prospective, non-randomized study. The data was taken post radiotherapy.
Collection MethodSaliva (200 µl) was centrifuged (2000 g, 10 min)
Analysis MethodqRT-PCR
Collection SiteSaliva
Disease CategoryCancer
Disease/ConditionHead and Neck Cancer
Disease SubtypeHead and Neck Squamous Cell Carcinoma (HNSCC)
Fold Change/ ConcentrationNA
Up/DownregulatedNA
ExosomalNA
OrganismHomo sapiens
PMID28677748
Year of Publication2017
Biomarker IDhsa-miR-200a
Biomarker CategorymiRNA
SequenceCCGGGCCCCUGUGAGCAUCUUACCGGACAGUGCUGGAUUUCCCAGCUUGACUCUAACACUGUCUGGUAACGAUGUUCAAAGGUGACCCGC
Title of studySalivary miR-93 and miR-200a as post-radiotherapy biomarkers in head and neck squamous cell carcinoma
Abstract of studyHead and neck squamous cell carcinoma is the 6th most malignant tumor entity worldwide and has exhibited a 5-year mortality of approximately 50% for the last fifty years. For the therapy monitoring and successful management of this tumor entity new and easily accessible biomarkers are greatly needed. The aim of the study was to determine whether and to what extent microRNAs, a class of small regulatory RNAs, are detectable in saliva post-radiation therapy. The expression and feasibility as therapy monitoring marker of the microRNAs were analyzed by RT-qPCR in 83 saliva samples from 33 patients collected at several time points pre-, during and post-radiotherapy treatment. Ten head and neck squamous cell carcinoma- or radiation-associated microRNAs (miR-93, miR-125a, miR-142-3p, miR-200a, miR-203, miR-213, let-7a, let-7b, let-7g and let-7i) were analyzed. All were detectable to a different extent in the saliva of the patients. miR-93 and miR-200a were significantly higher expressed 12 months post-radiotherapy than at baseline (p=0.047 and p=0.036). These results point towards miR-93 and miR-200a as biomarkers for the treatment monitoring post-radiation of head and neck squamous cell carcinoma.