Primary information |
---|
SALID | SAL_24523 |
Biomarker name | hsa-miR-320a |
Biomarker Type | Diagnostic |
Sampling Method | Whole unstimulated saliva samples were gathered from a study group of 62 selected subjects, consisting of 32 patients with Oral lichen planus, (including 22 patients with dysplastic lesions), 15 with biopsy-confirmed OSCC and 15 clinically healthy controls |
Collection Method | Roughly 5 ml of saliva from each field was picked up in a 50 ml centrifuge tube according to Navazesh method (Navazesh 1993). |
Analysis Method | qRT-PCR |
Collection Site | Saliva |
Disease Category | Inflammatory Disorder |
Disease/Condition | Oral Lichen Planus (OLP) and Dysplasia |
Disease Subtype | NA |
Fold Change/ Concentration | 0.4 |
Up/Downregulated | Downregulated |
Exosomal | NA |
Organism | Homo sapiens |
PMID | 28502067 |
Year of Publication | 2017 |
Biomarker ID | hsa-miR-320a |
Biomarker Category | miRNA |
Sequence | CUCCCCUCCGCCUUCUCUUCCCGGUUCUUCCCGGAGUCGGGAAAAGCUGGGUUGAGAGGGCGAAAAAGGAUG |
Title of study | Predictive value of salivary microRNA-320a, vascular endothelial growth factor receptor 2, CRP and IL-6 in Oral lichen planus progression |
Abstract of study | INTRODUCTION: MicroRNA (miRNA) 320a and vascular endothelial growth factor receptor 2 (VEGFR-2) expression as the angiogenic biomarkers might be therapeutic targets in Oral lichen planus (OLP). IL-6 and C-reactive protein (CRP) could be prognostic in OLP, dysplastic OLP and Oral squamous cell carcinoma (OSCC). Therefore, their salivary detections as the noninvasive tools were aimed in this study.MATERIALS AND METHODS: Histopathologic examinations were carried out to distinguish the patients with dysplastic OLP and OSCC. Salivary microRNA expression analysis was performed using RT-qPCR. IL-6 and CRP levels were also measured in saliva via ELISA method. VEGFR-2 expression in various sections was evaluated using immunohistochemistry.RESULTS: A significant decrease in salivary microRNA-320a in dysplastic OLP and OSCC but not in OLP without dysplasia was found. VEGFR-2 visualization confirmed the increasing angiogenic process in these cases. A significant increase in IL-6 level was detected in cases with OLP, dysplastic OLP and OSCC. CRP levels also showed a significant increase in dysplastic OLP and OSCC. A positive correlation between IL-6 and CRP levels was found.CONCLUSION: Identification of the salivary microRNA-320a and hs-CRP might provide a convenient noninvasive predictive tool for dysplastic OLP, whereas IL-6 could be a diagnostic and therapeutic target in both OLP without dysplasia and dysplastic OLP cases. |