| Primary information |
|---|
| SALID | SAL_24522 |
| Biomarker name | hsa-miR-126 |
| Biomarker Type | Diagnostic |
| Sampling Method | Forty pSS patients and 20 sex- and age-matched healthy volunteers were included. |
| Collection Method | Minor salivary gland (MSG) biopsies were obtained as part of routine diagnostic procedures in pSS patients. |
| Analysis Method | RT-PCR |
| Collection Site | Salivary gland |
| Disease Category | Immune System Disorder |
| Disease/Condition | Primary Sjogren's Syndrome |
| Disease Subtype | NA |
| Fold Change/ Concentration | NA |
| Up/Downregulated | NA |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 28339625 |
| Year of Publication | 2017 |
| Biomarker ID | hsa-miR-126 |
| Biomarker Category | miRNA |
| Sequence | CGCUGGCGACGGGACAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAACUCGUACCGUGAGUAAUAAUGCGCCGUCCACGGCA |
| Title of study | Cystatin S-a candidate biomarker for severity of submandibular gland involvement in Sjögren's syndrome |
| Abstract of study | OBJECTIVES: Salivary cystatin S is a defence protein mainly produced by submandibular glands and involved in innate oral immunity. This study aimed to verify whether cystatin S was diversely expressed in different disease subsets of primary Sjogren's syndrome (pSS) patients, defined on the basis of salivary flow [unstimulated salivary flow rate (USFR)], minor salivary gland (MSG) focus score and submandibular gland ultrasonography abnormalities. We also evaluated miR-126 and miR-335-5p expression in MSG biopsies to verify whether an aberrant regulation of cystatin S at the glandular level may influence its salivary expression.METHODS: Forty pSS patients and 20 sex- and age-matched healthy volunteers were included. Salivary cystatin S levels were assessed by western blot analysis using a stain-free technology. The expression of miR-126, miR-335-5p and cystatin S was assessed by quantitative PCR in 15 MSG biopsies differing for USFR and MSG focus score.RESULTS: We found that salivary cystatin S was significantly decreased in pSS patients vs healthy volunteers ( P = 0.000), especially in those with hyposalivation. A positive correlation was observed between cystatin S and USFR ( r = 0.75, P = 0.01). Salivary cystatin S was also significantly reduced in patients with a submandibular gland ultrasonography score ⩾2. The expression levels of miR-126 and miR-335-5P increased in inverse proportion with USFR. The mRNA of cystatin S did not change significantly, suggesting post-transcriptional regulation.CONCLUSION: Cystatin S emerged as a promising biomarker for pSS, strongly correlated with glandular dysfunction. An upregulation of miR-126 and miR-335-5P might be implicated in its expression. |