| Primary information |
|---|
| SALID | SAL_24520 |
| Biomarker name | hsa-miR-21 |
| Biomarker Type | Diagnostic |
| Sampling Method | Thirty-one samples of from patients with CRC at stages II-IV. Thirty-four EDTA stabilized peripheral blood samples and 34 saliva samples were collected from healthy volunteers. |
| Collection Method | Saliva collection was carried out in the morning on an empty stomach, after a light oral hygiene rinsing with 100 ml of sterile water. |
| Analysis Method | qRT-PCR |
| Collection Site | Saliva |
| Disease Category | Cancer |
| Disease/Condition | Colorectal Cancer (CRC) |
| Disease Subtype | Colon Cancer |
| Fold Change/ Concentration | 4 |
| Up/Downregulated | Upregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 27910062 |
| Year of Publication | 2020 |
| Biomarker ID | hsa-miR-21 |
| Biomarker Category | miRNA |
| Sequence | UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA |
| Title of study | Plasma and saliva miR-21 expression in colorectal cancer patients |
| Abstract of study | MicroRNA-21 (miR-21) expression was quantified by real-time qRT-PCR in peripheral blood and saliva samples obtained from patients diagnosed with colorectal cancer (CRC) of varying degrees of malignancy and healthy volunteers. All patients had adenocarcinoma located in the distal colon at different stages. Significant differences were detected between the control group and the total experimental group of CRC patients (plasma, P = 0.0001; saliva, P = 5e-12). MiR-21 expression was also significantly different in certain subgroups of patients with CRC disease stages II-IV as compared to the control group. No correlation of miR-21 expression was found with regard to gender and age of patents. Also, there were no significant individual correlations and linear regression of miR-21 expression in the plasma and saliva. The estimated diagnostic sensitivity and specificity of miR-21 expression were respectively 65 and 85% in the plasma, and 97 and 91% in the saliva. Our data suggest that miR-21 in both the saliva and plasma could be a proper biomarker for CRC screening, although the saliva miR-21 expression test looks preferable due to its higher sensitivity, specificity, and technical simplicity. |