Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_24515 details
Primary information
SALIDSAL_24515
Biomarker namehsa-miR-1246
Biomarker TypeDiagnostic
Sampling MethodTwelve patients (6 males and 6 females) with pancreatobiliary tract cancers
Collection MethodAt least 0.5 ml of unstimulated whole saliva was collected.
Analysis MethodqRT-PCR
Collection SiteSaliva
Disease CategoryCancer
Disease/ConditionPancreatobiliary Tract Cancer
Disease SubtypePancreatic Cancer
Fold Change/ Concentration14.6
Up/DownregulatedUpregulated
ExosomalExosomal
OrganismHomo sapiens
PMID27573701
Year of Publication2016
Biomarker IDhsa-miR-1246
Biomarker CategorymiRNA
SequenceUGUAUCCUUGAAUGGAUUUUUGGAGCAGGAGUGGACACCUGACCCAAAGGAAAUCAAUCCAUAGGCUAGCAAU
Title of studymiR‑1246 and miR‑4644 in salivary exosome as potential biomarkers for pancreatobiliary tract cancer
Abstract of studyPancreatobiliary tract cancer is a highly fatal cancer. Detection of pancreatobiliary tract cancer is difficult because it lacks typical clinical symptoms and because of its anatomical location. Biomarker discovery is therefore important to detect pancreatobiliary tract cancer in its early stage. A study demonstrated that expression levels of miR‑1246, miR‑3976, miR‑4306, and miR‑4644 in serum exosomes were higher in pancreatic cancer patients than these levels in healthy control participants. Supposing that microRNA (miRNA) expression profiles in saliva are similar to those in serum, four miRNAs (miR‑1246, miR‑3976, miR‑4306, and miR‑4644) in salivary exosomes may also be useful for detection of pancreatobiliary tract cancer. In this study, it was examined whether these miRNAs could be used as biomarkers for pancreatobiliary tract cancer. Twelve pancreatobiliary tract cancer patients and 13 healthy control participants were analyzed as a cancer and a control group, respectively. Unstimulated whole saliva was collected, salivary exosomes were isolated, and total RNA was extracted. Using quantitative real‑time PCR (RT‑qPCR), the relative expression ratios of miR‑1246 and miR‑4644 were significantly higher in the cancer group than these ratios in the control group. Receiver operating characteristic (ROC) curves were constructed to analyze the discrimination power of these miRNAs. For miR‑1246, the results yielded an area under the curve (AUC) of 0.814 (P=0.008). For miR‑4644, the results yielded an AUC of 0.763 (P=0.026). For the combination of miR‑1246 and miR‑4644, the results yielded an increased AUC of 0.833 (P=0.005). This pilot study suggests that miR‑1246 and miR‑4644 in salivary exosomes could be candidate biomarkers for pancreatobiliary tract cancer.