| Primary information |
|---|
| SALID | SAL_24497 |
| Biomarker name | hsa-miR-139-5p |
| Biomarker Type | Diagnostic |
| Sampling Method | A total of 50 saliva samples was collected from 25 TSCC patients |
| Collection Method | The saliva samples were collected in the morning, and participants were asked to stop eating, drinking and oral hygiene at least 1 hour before collection. |
| Analysis Method | qRT-PCR |
| Collection Site | Saliva |
| Disease Category | Cancer |
| Disease/Condition | Tongue Squamous Cell Carcinoma (TSCC) |
| Disease Subtype | Oral Cancer |
| Fold Change/ Concentration | >1.4 |
| Up/Downregulated | Downregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 26650483 |
| Year of Publication | 2016 |
| Biomarker ID | hsa-miR-139-5p |
| Biomarker Category | miRNA |
| Sequence | UCUACAGUGCACGUGUCUCCAGU |
| Title of study | Identification of miR-139-5p as a saliva biomarker for tongue squamous cell carcinoma: a pilot study |
| Abstract of study | BACKGROUND: Of all human oral carcinomas, 41 % are localized to the tongue. Despite considerable improvements in both diagnosis and treatment, tongue squamous cell carcinoma (TSCC) has remained one of the most lethal types of cancer. Here, we aimed at identifying a salivary microRNA (miRNA) expression signature specific for TSCC patients.METHODS: To identify putative diagnostic biomarkers, we compared the miRNA expression profiles of saliva samples from three TSCC patients and four healthy control individuals using an Agilent miRNA microarray platform (V19). Three of the differentially expressed miRNAs identified were selected for further validation using quantitative reverse-transcription PCR (qRT-PCR) in saliva samples from 25 TSCC patients and 25 healthy control individuals.RESULTS: Through microarray-based expression profiling, we found that 419 miRNAs were deregulated in the saliva samples from the TSCC patients compared to those from the healthy control individuals tested. Subsequent qRT-PCR analysis revealed that the expression level of miR-139-5p was significantly reduced in the TSCC validation samples compared to the controls. Further analysis of post-operative saliva samples derived from TSCC patients revealed that the miR-139-5p expression levels had turned back to normal again. In addition, we found that miR-139-5p exhibited enough power to discriminate pre-operative TSCC patients from both normal individuals (AUC: 0.805) and post-operative TSCC patients (AUC: 0.713), thereby underscoring its diagnostic potential.CONCLUSIONS: From our results we conclude that saliva can be used as a feasible source for routine TSCC diagnostics and that miR-139-5p may serve as a potential biomarker for early TSCC detection. |