Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_24486 details
Primary information
SALIDSAL_24486
Biomarker namehsa-miR-24-3p
Biomarker TypeNA
Sampling MethodBody fluid samples were collected from 5 unrelated healthy individual donors after receiving written informed consents.
Collection MethodUnstimulated (at least 1 h after eating or drinking) saliva was collected in plastic tubes, and 300mL was used to extract total RNA.
Analysis MethodNGS
Collection SiteSaliva
Disease CategoryHealthy
Disease/ConditionHealthy
Disease SubtypeNA
Fold Change/ ConcentrationNA
Up/DownregulatedNA
ExosomalNA
OrganismHomo sapiens
PMID26600000
Year of Publication2016
Biomarker IDhsa-miR-24-3p
Biomarker CategorymiRNA
SequenceUGGCUCAGUUCAGCAGGAACAG
Title of studyCharacterization of microRNA expression profiles in blood and saliva using the Ion Personal Genome Machine(®) System (Ion PGM™ System)
Abstract of studyMicroRNA (miRNA) expression profiling is gaining interest in the forensic community because the intrinsically short fragment and tissue-specific expression pattern enable miRNAs as a useful biomarker for body fluid identification. Measuring the quantity of miRNAs in forensically relevant body fluids is an important step to screen specific miRNAs for body fluid identification. The recent introduction of massively parallel sequencing (MPS) has the potential for screening miRNA biomarkers at the genome-wide level, which allows both the detection of expression pattern and miRNA sequences. In this study, we employed the Ion Personal Genome Machine(®) System (Ion PGM™ System, Thermo Fisher) to characterize the distribution and expression of 2588 human mature miRNAs (miRBase v21) in 5 blood samples and 5 saliva samples. An average of 1,885,000 and 1,356,000 sequence reads were generated in blood and saliva respectively. Based on miRDong, a Perl-based tool developed for semi-automated miRNA distribution designations, and manually ascertained, 6 and 19 miRNAs were identified respectively as potentially blood and saliva-specific biomarkers. Herein, this study describes a complete and reliable miRNA workflow solution based on Ion PGM™ System, starting from efficient RNA extraction, followed by small RNA library construction and sequencing. With this workflow solution and miRDong analysis it will be possible to measure miRNA expression pattern at the genome-wide level in other forensically relevant body fluids.