Primary information |
---|
SALID | SAL_24478 |
Biomarker name | hsa-miR-103a-3p |
Biomarker Type | Diagnostic |
Sampling Method | The set consisted of 32 randomly selected unstimulated whole saliva samples from patients with a parotid gland neoplasm and was obtained from the SGTB; 14 were collected |
Collection Method | Saliva samples were thawed and centrifuged. The cell-free supernatant (cleared saliva) was collected. Total RNA was isolated from cleared saliva using RNA extraction kits (Ambion mirVana Paris kit). |
Analysis Method | qRT-PCR |
Collection Site | Whole Saliva |
Disease Category | Cancer |
Disease/Condition | Parotid Salivary Gland Neoplasms |
Disease Subtype | Oral Cancer |
Fold Change/ Concentration | NA |
Up/Downregulated | Upregulated |
Exosomal | NA |
Organism | Homo sapiens |
PMID | 26544193 |
Year of Publication | 2016 |
Biomarker ID | hsa-miR-103a-3p |
Biomarker Category | miRNA |
Sequence | AGCAGCAUUGUACAGGGCUAUGA |
Title of study | Human Salivary Micro-RNA in Patients with Parotid Salivary Gland Neoplasms |
Abstract of study | BACKGROUND: Currently, clinical examination, ultrasound scanning (with or without fine needle aspiration cytology), preoperative CT-scan and MRI are available for the differential diagnosis of parotid gland swelling. A preliminary non-invasive salivary diagnostic tool may be helpful in the clinical decision making process. Altered salivary micro-RNA (miRNA) expression levels have been observed in saliva from patients with various cancers. Therefore, we investigated miRNA expression levels in saliva samples from patients with a parotid gland neoplasm using Human miRNA cards in comparison to controls.RESULTS: In the discovery phase, eight miRNAs were identified having different expression levels in patients compared to controls. In the validation phase, the differences in miRNA expression levels between patients and controls were confirmed for seven out of eight discovered miRNAs (p < 0.001). A combination of two miRNAs yielded a receiver-operator-characteristics curve with an AUC of 0.94 (95% CI: 0.87-1.00; sensitivity 91%; specificity 86%). Validation of discovered miRNAs in segregated collected parotid saliva revealed that expression of these miRNAs differ between whole saliva and parotid saliva.CONCLUSIONS: A two miRNA combination can predict the presence of a parotid gland neoplasm. Furthermore, this study suggested that the identified, patient-specific, salivary miRNAs were not derived from the parotid gland itself. |