| Primary information |
|---|
| SALID | SAL_24467 |
| Biomarker name | hsa-miR-4484 |
| Biomarker Type | Diagnostic |
| Sampling Method | Saliva samples from 16 patients with oral lichen planus and 8 healthy controls were divided into 2 sets and examined using miRNA microarray analysis and TaqMan quantitative PCR. |
| Collection Method | About 5-10 ml of unstimulated whole saliva was collected from both the OLP patients and healthy controls. Exosomes were isolated using ExoQuick precipitation solution (SBI, Mountain View, CA, USA) |
| Analysis Method | qRT-PCR |
| Collection Site | Supernatant Saliva |
| Disease Category | Autoimmune Disorder |
| Disease/Condition | Oral Lichen Planus (OLP) |
| Disease Subtype | NA |
| Fold Change/ Concentration | 13.69 |
| Up/Downregulated | Upregulated |
| Exosomal | Exosomal |
| Organism | Homo sapiens |
| PMID | 26389700 |
| Year of Publication | 2015 |
| Biomarker ID | hsa-miR-4484 |
| Biomarker Category | miRNA |
| Sequence | GGGUUUCCUCUGCCUUUUUUUCCAAUGAAAAUAACGAAACCUGUUAUUUCCCAUUGAGGGGGAAAAAGGCGGGAGAAGCCCCA |
| Title of study | Diagnostic profiling of salivary exosomal microRNAs in oral lichen planus patients |
| Abstract of study | OBJECTIVE: Oral lichen planus is a chronic inflammatory oral mucosal disease whose exact cause is unclear and which requires efficient diagnostic and therapeutic strategies. Identification of disease-specific biomarkers in saliva is an easy, quick, and non-invasive approach for molecular diagnosis. This study was designed to examine salivary exosomal microRNAs (miRNAs) that could be candidates for diagnosing and elucidating the pathogenesis of oral lichen planus.SUBJECTS AND METHODS: We compared miRNA profiles of salivary exosomes of patients with oral lichen planus with those of healthy controls. Saliva samples from 16 patients with oral lichen planus and eight healthy controls were divided into two sets and examined using miRNA microarray analysis and TaqMan quantitative PCR.RESULTS: The three miRNAs identified (miR-4484, miR-1246, and miR-1290) were further validated. Of these, miR-4484 was significantly upregulated in the salivary exosomes of patients with oral lichen planus.CONCLUSIONS: This study thus identifies a potential miRNA biomarker for oral lichen planus and provides insight into the functions of miRNAs in the pathogenesis of oral inflammatory diseases. |