Primary information |
---|
SALID | SAL_24443 |
Biomarker name | hsa-miR-4725-3p |
Biomarker Type | NA |
Sampling Method | 15 young participants and 14 old participants were recruited in this study. The participants with hypertension and dyslipidemia (two old participants), hyperuricemia (one old participant), and asthma (one young participant) were included. |
Collection Method | From the collected plasma and salivary samples, miRs were extracted using trizol and chloroform, and were purified using a spin column method (Qiagen, Hilden, Germany). |
Analysis Method | qRT-PCR |
Collection Site | Saliva |
Disease Category | Ageing |
Disease/Condition | Age-related |
Disease Subtype | NA |
Fold Change/ Concentration | 5.02 |
Up/Downregulated | Upregulated |
Exosomal | Exosomal |
Organism | Homo sapiens |
PMID | 26370963 |
Year of Publication | 2015 |
Biomarker ID | hsa-miR-4725-3p |
Biomarker Category | miRNA |
Sequence | UGGGGAAGGCGUCAGUGUCGGG |
Title of study | MicroRNAs in Salivary Exosome as Potential Biomarkers of Aging |
Abstract of study | The aim of this study was to examine whether salivary exosomal miRNAs could be identified as aging biomarkers. Fifteen young healthy volunteers (median age, 21.0 years) and 13 old individuals (median age, 66.0 years) were recruited. Unstimulated whole saliva was collected, salivary exosomes were isolated, and total RNA was extracted. In a microarray, 242 miRNAs were commonly detected in these two mixed samples. Based on the cut-off values of 2- or 0.5-fold changes (FC) and regulatory power for aging process, six candidate miRNAs (miR-24-3p, miR-371a-5p, miR-3175, miR-3162-5p, miR-671-5p, and miR-4667-5p) were selected. After comparing each total RNA obtained by the 15 young and 13 old individuals to validate the FC values using quantitative real-time PCR, miR-24-3p was identified as a novel candidate aging biomarker. This pilot study suggested that salivary exosomal miRNAs could be identified as candidate aging biomarkers. To confirm whether miR-24-3p in salivary exosomes are suitable biomarkers of aging, further validation research is required. |