| Primary information |
|---|
| SALID | SAL_24404 |
| Biomarker name | hsa-miR-200b |
| Biomarker Type | Diagnostic |
| Sampling Method | Salivary samples were collected from patients with PDAC and healthy controls, and miRNA levels were quantified using qRTPCR. Twenty-four patients with PDAC and 10 healthy controls were recruited. |
| Collection Method | All serum and saliva samples were thawed on ice, and the miRNA fraction was obtained from an input of 500 mL of each sample |
| Analysis Method | qRT-PCR |
| Collection Site | Saliva |
| Disease Category | Cancer |
| Disease/Condition | Pancreatic Ductal Adenocarcinoma (PDAC) |
| Disease Subtype | Pancreatic Cancer |
| Fold Change/ Concentration | NA |
| Up/Downregulated | NA |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 26262588 |
| Year of Publication | 2016 |
| Biomarker ID | hsa-miR-200b |
| Biomarker Category | miRNA |
| Sequence | CCAGCUCGGGCAGCCGUGGCCAUCUUACUGGGCAGCAUUGGAUGGAGUCAGGUCUCUAAUACUGCCUGGUAAUGAUGACGGCGGAGCCCUGCACG |
| Title of study | miRNA-21 and miRNA-34a Are Potential Minimally Invasive Biomarkers for the Diagnosis of Pancreatic Ductal Adenocarcinoma |
| Abstract of study | OBJECTIVES: Pancreatic ductal adenocarcinoma (PDAC) is one of the most deadly cancers, and its diagnosis often requires invasive procedures. Deregulated miRNA expression has been described in patients with PDAC. In this study, we analyzed the expression levels of 6 miRNAs (miR-21, -34a, -155, -196a, -200b, and -376a involved in PDAC tumorigenesis) in serum and salivary samples to assess their potential role as circulating diagnostics biomarkers.METHODS: Serum and salivary samples were collected from patients with PDAC and healthy controls, and miRNA levels were quantified using qRT-PCR. Twenty-four patients with PDAC and 10 healthy controls were recruited.RESULTS: A significant difference between PDAC and healthy groups was observed for the expression of miR-21 and miR-34a (P < 0.001 and P = 0.001) in serum samples. Both miRNAs accurately discriminated between the 2 groups, with an area under the curve for miR-21 and miR-34a of 0.889 (P = 0.001) and 0.865 (P = 0.002), respectively. In general, the expression of miRNAs between salivary samples did not differ.CONCLUSIONS: Serum miR-21 and miR-34a are potentially useful diagnostic biomarkers of PDAC. In addition, our results suggest that these miRNAs are not differentially expressed in saliva, making them unsuitable for use as noninvasive biomarkers for diagnostic purposes. |