| Primary information |
|---|
| SALID | SAL_24385 |
| Biomarker name | hsa-miR-184 |
| Biomarker Type | Diagnostic |
| Sampling Method | 20 clinically healthy controls, 40 patients with oral potentially malignant disorders (PMDs), 20 with biopsy-confirmed oral squamous cell carcinoma (OSCC), and 20 with recurrent aphthous stomatitis (RAS) as disease controls. |
| Collection Method | About 5 ml saliva was collected and centrifuged at 2500 g for 10 min at 4degreeC. miRNA extraction performed using 1 ml QIAzol lysis reagent and incubated for 5 min at room temperature (20degreeC). |
| Analysis Method | qRT-PCR |
| Collection Site | Saliva |
| Disease Category | Cancer |
| Disease/Condition | Oral Potentially Malignant Disorders (OPMD) |
| Disease Subtype | Oral Cancer |
| Fold Change/ Concentration | >2 |
| Up/Downregulated | Upregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 25784212 |
| Year of Publication | 2015 |
| Biomarker ID | hsa-miR-184 |
| Biomarker Category | miRNA |
| Sequence | CCAGUCACGUCCCCUUAUCACUUUUCCAGCCCAGCUUUGUGACUGUAAGUGUUGGACGGAGAACUGAUAAGGGUAGGUGAUUGA |
| Title of study | Salivary microRNAs in oral cancer |
| Abstract of study | OBJECTIVE: This study investigated the use of three salivary microRNAs (miRNA-21, miRNA-184, and miRNA-145) as possible markers for malignant transformation in oral mucosal lesions.MATERIALS AND METHODS: Salivary whole unstimulated samples were collected from a study group of 100 subjects, consisting of 20 clinically healthy controls, 40 patients with oral potentially malignant disorders (PMDs) [20 with dysplastic lesions and 20 without dysplasia], 20 with biopsy-confirmed oral squamous cell carcinoma (OSCC), and 20 with recurrent aphthous stomatitis (RAS) as disease controls. Total RNA was isolated and purified from saliva samples using the microRNA Isolation Kit (Qiagen, UL). miRNA expression analysis was performed using qRT-PCR (Applied Biosystems).RESULTS: There was a highly significant increase in salivary miRNA-21 and miRNA-184 in OSCC and PMD (with and without dysplasia) when compared to healthy and disease controls (P < 0.001). Conversely, miRNA-145 levels showed a highly significant decrease in OSCC and PMD overall (P < 0.001). RAS cases showed no significant difference from normal controls in any measured miRNA (P > 0.05). The only microRNA to discriminate between OSCC and PMD with dysplasia was miRNA-184. When receiver operating characteristic curves were designed for the three miRNAs, cutoff points delineating the occurrence of malignant change were a fourfold increase in miRNA-21 with specificity 65% and sensitivity 65%, a 0.6 decrease in miRNA-145, with specificity 70% and sensitivity 60%, and a threefold increase of miRNA-184, with specificity 75% and sensitivity 80%. Calculating the area under the curve revealed that miRNA-184 was the only one among the studied miRNAs that provided good diagnostic value.CONCLUSION: Salivary determination of the miRNAs tested might furnish a noninvasive, rapid adjunctive aid for revealing malignant transformation in oral mucosal lesions, particularly miRNA-184. |