Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_24380 details
Primary information
SALIDSAL_24380
Biomarker namehsa-miR-203a
Biomarker TypeNA
Sampling MethodEach body fluid specimen was collected from 10 unrelated individuals (age: 18 to 47 years old).
Collection MethodUnstimulated (at least 1 h after eating or drinking) saliva was collected in plastic tubes, and 50 microliter was placed on each sterile cotton swab.
Analysis MethodqRT-PCR
Collection SiteSaliva
Disease CategoryHealthy
Disease/ConditionHealthy
Disease SubtypeNA
Fold Change/ ConcentrationNA
Up/DownregulatedNA
ExosomalNA
OrganismHomo sapiens
PMID25690121
Year of Publication2015
Biomarker IDhsa-miR-203a
Biomarker CategorymiRNA
SequenceGUGUUGGGGACUCGCGCGCUGGGUCCAGUGGUUCUUAACAGUUCAACAGUUCUGUAGCGCAAUUGUGAAAUGUUUAGGACCACUAGACCCGGCGGGCGCGGCGACAGCGA
Title of studyIdentification of Saliva Using MicroRNA Biomarkers for Forensic Purpose
Abstract of studyIn the forensic science community, microRNA (miRNA) profiling has started to be explored as an alternative tool for body fluid identification. Several origins of body fluid can be distinguished by measuring differential expression patterns of particular miRNAs. However, most of reported saliva miRNAs are nonoverlapping and debatable. The aim of this study was to develop a strategy of identifying saliva using miRNA biomarkers for forensic purpose. Eight miRNA candidates were selected to examine expression abundance in forensically relevant body fluids using hydrolysis probes quantitative real-time PCR (TaqMan qPCR). Results revealed that none of them was truly saliva specific, and only miR-200c-3p, miR-203a, and miR-205-5p were higher or more moderate expression in saliva. A stepwise strategy that combines each of three miRNAs with different body fluid-specific miRNAs was developed, and three miRNA combinations could effectively differentiate saliva from other body fluids.