Primary information |
---|
SALID | SAL_24379 |
Biomarker name | hsa-miR-205-5p |
Biomarker Type | NA |
Sampling Method | Each body fluid specimen was collected from 10 unrelated individuals (age: 18 to 47 years old). |
Collection Method | Unstimulated (at least 1 h after eating or drinking) saliva was collected in plastic tubes, and 50 microliter was placed on each sterile cotton swab. |
Analysis Method | qRT-PCR |
Collection Site | Saliva |
Disease Category | Healthy |
Disease/Condition | Healthy |
Disease Subtype | NA |
Fold Change/ Concentration | NA |
Up/Downregulated | NA |
Exosomal | NA |
Organism | Homo sapiens |
PMID | 25690121 |
Year of Publication | 2015 |
Biomarker ID | hsa-miR-205-5p |
Biomarker Category | miRNA |
Sequence | UCCUUCAUUCCACCGGAGUCUG |
Title of study | Identification of Saliva Using MicroRNA Biomarkers for Forensic Purpose |
Abstract of study | In the forensic science community, microRNA (miRNA) profiling has started to be explored as an alternative tool for body fluid identification. Several origins of body fluid can be distinguished by measuring differential expression patterns of particular miRNAs. However, most of reported saliva miRNAs are nonoverlapping and debatable. The aim of this study was to develop a strategy of identifying saliva using miRNA biomarkers for forensic purpose. Eight miRNA candidates were selected to examine expression abundance in forensically relevant body fluids using hydrolysis probes quantitative real-time PCR (TaqMan qPCR). Results revealed that none of them was truly saliva specific, and only miR-200c-3p, miR-203a, and miR-205-5p were higher or more moderate expression in saliva. A stepwise strategy that combines each of three miRNAs with different body fluid-specific miRNAs was developed, and three miRNA combinations could effectively differentiate saliva from other body fluids. |