Primary information |
---|
SALID | SAL_23248 |
Biomarker name | miR-212 |
Biomarker Type | Diagnostic |
Sampling Method | Of all the patients (patient group), 17 were males and 13 were females, with age ranged from 33 to 78 years, and all were not treated before this study |
Collection Method | Saliva was centrifugated at 2500 g for 10min and the supernatant was collected and centrifuged at 10,000 g for 1min to remove remaining cells. |
Analysis Method | qRT-PCR |
Collection Site | Supernatant Saliva |
Disease Category | Cancer |
Disease/Condition | Pancreatic Cancer |
Disease Subtype | NA |
Fold Change/ Concentration | NA |
Up/Downregulated | NA |
Exosomal | NA |
Organism | Homo sapiens |
PMID | 25126577 |
Year of Publication | 2014 |
Biomarker ID | hsa-miR-212 |
Biomarker Category | miRNA |
Sequence | CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGGCCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCC |
Title of study | MicroRNA expression in salivary supernatant of patients with pancreatic cancer and its relationship with ZHENG |
Abstract of study | In traditional Chinese medicine (TCM), diagnosis and prescriptions are based on the signs and symptoms which are recognized as ZHENG. The cornerstone of TCM is to differentially treat one ZHENG from others, which is also known as syndrome differentiation, and this relies on the gathering of clinical information through inspection, auscultation and olfaction, inquiry, and palpation. However, the biomolecular basis of the ZHENG remains unclear. In this study, the expressions of 384 cancer-related miRNAs in salivary supernatant of patients with pancreatic cancer were assessed by miRNA polymerase chain reaction (PCR) array, and the different expression patterns of miRNA in three different groups of ZHENG were studied with use of real-time quantitative PCR (qRT-PCR). Some miRNAs were found to be specifically expressed in some ZHENGs, for instance, miR-17, miR-21, and miR-181b in Shi-Re ZHENG and miR-196a in Pi-Xu ZHENG. This indicates that these miRNAs may play important roles in different ZHENG condition. Therefore, this study to some extent revealed the molecular basis of TCM ZHENG in pancreatic cancer. |