Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_23248 details
Primary information
SALIDSAL_23248
Biomarker namemiR-212
Biomarker TypeDiagnostic
Sampling MethodOf all the patients (patient group), 17 were males and 13 were females, with age ranged from 33 to 78 years, and all were not treated before this study
Collection MethodSaliva was centrifugated at 2500 g for 10min and the supernatant was collected and centrifuged at 10,000 g for 1min to remove remaining cells.
Analysis MethodqRT-PCR
Collection SiteSupernatant Saliva
Disease CategoryCancer
Disease/ConditionPancreatic Cancer
Disease SubtypeNA
Fold Change/ ConcentrationNA
Up/DownregulatedNA
ExosomalNA
OrganismHomo sapiens
PMID25126577
Year of Publication2014
Biomarker IDhsa-miR-212
Biomarker CategorymiRNA
SequenceCGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGGCCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCC
Title of studyMicroRNA expression in salivary supernatant of patients with pancreatic cancer and its relationship with ZHENG
Abstract of studyIn traditional Chinese medicine (TCM), diagnosis and prescriptions are based on the signs and symptoms which are recognized as ZHENG. The cornerstone of TCM is to differentially treat one ZHENG from others, which is also known as syndrome differentiation, and this relies on the gathering of clinical information through inspection, auscultation and olfaction, inquiry, and palpation. However, the biomolecular basis of the ZHENG remains unclear. In this study, the expressions of 384 cancer-related miRNAs in salivary supernatant of patients with pancreatic cancer were assessed by miRNA polymerase chain reaction (PCR) array, and the different expression patterns of miRNA in three different groups of ZHENG were studied with use of real-time quantitative PCR (qRT-PCR). Some miRNAs were found to be specifically expressed in some ZHENGs, for instance, miR-17, miR-21, and miR-181b in Shi-Re ZHENG and miR-196a in Pi-Xu ZHENG. This indicates that these miRNAs may play important roles in different ZHENG condition. Therefore, this study to some extent revealed the molecular basis of TCM ZHENG in pancreatic cancer.