Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_23231 details
Primary information
SALIDSAL_23231
Biomarker namehsa-miR-10a
Biomarker TypeDiagnostic
Sampling MethodNA
Collection MethodNA
Analysis MethodqPCR
Collection SiteSaliva
Disease CategoryCancer
Disease/ConditionPancreatic Cancer
Disease SubtypePancreatic Cancer
Fold Change/ Concentration32.82
Up/DownregulatedUpregulated
ExosomalNA
OrganismHomo sapiens
PMID25126577
Year of Publication2014
Biomarker IDhsa-miR-10a
Biomarker CategorymiRNA
SequenceGAUCUGUCUGUCUUCUGUAUAUACCCUGUAGAUCCGAAUUUGUGUAAGGAAUUUUGUGGUCACAAAUUCGUAUCUAGGGGAAUAUGUAGUUGACAUAAACACUCCGCUCU
Title of studyMicroRNA expression in salivary supernatant of patients with pancreatic cancer and its relationship with ZHENG
Abstract of studyIn traditional Chinese medicine (TCM), diagnosis and prescriptions are based on the signs and symptoms which are recognized as ZHENG. The cornerstone of TCM is to differentially treat one ZHENG from others, which is also known as syndrome differentiation, and this relies on the gathering of clinical information through inspection, auscultation and olfaction, inquiry, and palpation. However, the biomolecular basis of the ZHENG remains unclear. In this study, the expressions of 384 cancer-related miRNAs in salivary supernatant of patients with pancreatic cancer were assessed by miRNA polymerase chain reaction (PCR) array, and the different expression patterns of miRNA in three different groups of ZHENG were studied with use of real-time quantitative PCR (qRT-PCR). Some miRNAs were found to be specifically expressed in some ZHENGs, for instance, miR-17, miR-21, and miR-181b in Shi-Re ZHENG and miR-196a in Pi-Xu ZHENG. This indicates that these miRNAs may play important roles in different ZHENG condition. Therefore, this study to some extent revealed the molecular basis of TCM ZHENG in pancreatic cancer.