| Primary information |
|---|
| SALID | SAL_23170 |
| Biomarker name | miR-708 |
| Biomarker Type | Diagnostic |
| Sampling Method | About 45 patient in disease group and 7 healthy controls. The cohort is available in smokings habits and control group not matched with cohort |
| Collection Method | Saliva samples were collected from these patients whenever tissue biopsies were collected. |
| Analysis Method | qRT-PCR |
| Collection Site | Whole Saliva |
| Disease Category | Cancer |
| Disease/Condition | Oral Cancer |
| Disease Subtype | Oral Squamous Cell Carcinoma (OSCC) |
| Fold Change/ Concentration | NA |
| Up/Downregulated | Upregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 23510112 |
| Year of Publication | 2013 |
| Biomarker ID | hsa-miR-708 |
| Biomarker Category | miRNA |
| Sequence | AACUGCCCUCAAGGAGCUUACAAUCUAGCUGGGGGUAAAUGACUUGCACAUGAACACAACUAGACUGUGAGCUUCUAGAGGGCAGGGA |
| Title of study | Progress risk assessment of oral premalignant lesions with saliva miRNA analysis |
| Abstract of study | BACKGROUND: Oral cancer develops through multi-stages: from normal to mild (low grade) dysplasia (LGD), moderate dysplasia, and severe (high grade) dysplasia (HGD), to carcinoma in situ (CIS) and finally invasive oral squamous cell carcinomas (OSCC). Clinical and histological assessments are not reliable in predicting which precursor lesions will progress. The aim of this study was to assess the potential of a noninvasive approach to assess progress risk of oral precancerous lesions.METHODS: We first used microRNA microarray to profile progressing LGD oral premaligant lesions (OPLs) from non-progressing LGD OPLs in order to explore the possible microRNAs deregulated in low grade OPLs which later progressed to HGD or OSCC. We then used RT-qPCR to detect miRNA targets from the microarray results in saliva samples of these patients.RESULTS: We identified a specific miRNA signature that is aberrantly expressed in progressing oral LGD leukoplakias. Similar expression patterns were detected in saliva samples from these patients.CONCLUSIONS: These results show promise for using saliva miRNA signature for monitoring of cancer precursor lesions and early detection of disease progression. |