Primary information |
---|
SALID | SAL_23148 |
Biomarker name | hsa-miR-31 |
Biomarker Type | NA |
Sampling Method | Saliva was collected a week before surgery from 45 patients with OSCC and from 24 healthy individuals matched by age, sex, and oral habits served as controls. |
Collection Method | 3-5 ml of saliva were collected from the mouth floor after simple mouth rinsing. After centrifugation, the supernatant was aliquoted and preserved at 80 degree celcius. |
Analysis Method | qRT-PCR |
Collection Site | Supernatant Saliva |
Disease Category | Healthy |
Disease/Condition | NA |
Disease Subtype | Healthy |
Fold Change/ Concentration | NA |
Up/Downregulated | NA |
Exosomal | NA |
Organism | Homo sapiens |
PMID | 22083872 |
Year of Publication | 2012 |
Biomarker ID | hsa-miR-31 |
Biomarker Category | miRNA |
Sequence | GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC |
Title of study | Exploiting salivary miR-31 as a clinical biomarker of oral squamous cell carcinoma |
Abstract of study | BACKGROUND: Oral carcinoma is an important malignancy throughout the world. MicroRNAs (miRNAs) are endogenously expressed, non-coding RNAs that regulate post-transcriptional levels of targeted mRNAs. MiRNA-31(miR-31) is significantly upregulated in oral carcinoma tissues and plays oncogenic roles in oral carcinogenesis.METHODS: We analyzed the levels of miR-31 in saliva of patients with oral carcinoma (n = 45), oral verrucous leukoplakia (n = 10), and control healthy individuals (n = 24) by quantitative reverse transcriptase-polymerase chain reaction (RT-PCR).RESULTS: Salivary miR-31 was significantly increased in patients with oral carcinoma at all clinical stages, including very small tumors. However, our preliminary analysis showed no increase of salivary miR-31 in patients with oral verrucous leukoplakia relative to controls. The miR-31 was more abundant in saliva than in plasma, suggesting salivary miR-31 was a more sensitive marker for oral malignancy. After excision of oral carcinoma, salivary miR-31 was remarkably reduced, indicating that most of the upregulated salivary miR-31 came from tumor tissues.CONCLUSION: Our results point to a potential application of salivary miR-31 as a biomarker for early detection and postoperative follow-up of oral carcinoma. |