| Primary information |
|---|
| SALID | SAL_23147 |
| Biomarker name | hsa-miR-31 |
| Biomarker Type | Diagnostic |
| Sampling Method | Saliva was collected a week before surgery from 45 patients with OSCC and from 24 healthy individuals matched by age, sex, and oral habits served as controls. |
| Collection Method | 3-5 ml of saliva were collected from the mouth floor after simple mouth rinsing. After centrifugation, the supernatant was aliquoted and preserved at 80 degree celcius. |
| Analysis Method | qRT-PCR |
| Collection Site | Supernatant Saliva |
| Disease Category | Cancer |
| Disease/Condition | Oral Cancer |
| Disease Subtype | Oral squamous cell carcinoma (OSCC) |
| Fold Change/ Concentration | 10.89 |
| Up/Downregulated | Upregulated |
| Exosomal | NA |
| Organism | Homo sapiens |
| PMID | 22083872 |
| Year of Publication | 2012 |
| Biomarker ID | hsa-miR-31 |
| Biomarker Category | miRNA |
| Sequence | GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC |
| Title of study | Exploiting salivary miR-31 as a clinical biomarker of oral squamous cell carcinoma |
| Abstract of study | BACKGROUND: Oral carcinoma is an important malignancy throughout the world. MicroRNAs (miRNAs) are endogenously expressed, non-coding RNAs that regulate post-transcriptional levels of targeted mRNAs. MiRNA-31(miR-31) is significantly upregulated in oral carcinoma tissues and plays oncogenic roles in oral carcinogenesis.METHODS: We analyzed the levels of miR-31 in saliva of patients with oral carcinoma (n = 45), oral verrucous leukoplakia (n = 10), and control healthy individuals (n = 24) by quantitative reverse transcriptase-polymerase chain reaction (RT-PCR).RESULTS: Salivary miR-31 was significantly increased in patients with oral carcinoma at all clinical stages, including very small tumors. However, our preliminary analysis showed no increase of salivary miR-31 in patients with oral verrucous leukoplakia relative to controls. The miR-31 was more abundant in saliva than in plasma, suggesting salivary miR-31 was a more sensitive marker for oral malignancy. After excision of oral carcinoma, salivary miR-31 was remarkably reduced, indicating that most of the upregulated salivary miR-31 came from tumor tissues.CONCLUSION: Our results point to a potential application of salivary miR-31 as a biomarker for early detection and postoperative follow-up of oral carcinoma. |