Primary information |
---|
SALID | SAL_23145 |
Biomarker name | hsa-miR-31 |
Biomarker Type | Diagnostic |
Sampling Method | The saliva from nine patients was collected in the week prior to operation and 6 weeks after operation in 2009. The saliva collected from eight normal individuals was used as control. |
Collection Method | 5ml of saliva was collected from the floor of mouth after cleaning of oral cavity by mouth rinsing and saliva samples were centrifuged and supernatant phase of whole saliva was collected |
Analysis Method | qRT-PCR |
Collection Site | Supernatant Saliva |
Disease Category | Cancer |
Disease/Condition | Colon Cancer |
Disease Subtype | Colorectal cancer (CRC) |
Fold Change/ Concentration | NA |
Up/Downregulated | Upregulated |
Exosomal | NA |
Organism | Homo sapiens |
PMID | 20233326 |
Year of Publication | 2010 |
Biomarker ID | hsa-miR-31 |
Biomarker Category | miRNA |
Sequence | GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC |
Title of study | Increase of microRNA miR-31 level in plasma could be a potential marker of oral cancer |
Abstract of study | BACKGROUNDS: Oral squamous cell carcinoma (OSCC) is a worldwide disease. MicroRNAs are endogenously expressed non-coding RNAs that have important biological and pathological functions. miR-31 was found markedly up-regulated in OSCC and several other malignancies. However, miR-31 expression was also down-regulated in the metastasis process of breast carcinoma.MATERIALS AND METHODS: Using quantitative RT-PCR analysis, we identified plasma miR-31 in OSCC patients (n = 43) and case controlled individuals (n = 21). Nine OSCC patients saliva were also analyzed. The Mann-Whitney test and Wilcoxon matched pairs test were used to compare the differences among the various clinical variants.RESULTS: miR-31 in plasma was significantly elevated in OSCC patients relative to age and sex-matched control individuals. This marker yielded a receiver operating characteristic curve area of 0.82 and an accuracy of 0.72 defined by leave-one-out cross-validation. In addition, the plasma miR-31 in patients was remarkably reduced after tumor resection suggesting that this marker is tumor associated. Our preliminary analysis also demonstrated the feasibility of detecting the increase of miR-31 in patient's saliva.CONCLUSION: This study concluded that plasma miR-31 could be validated a marker of OSCC for diagnostic uses. |