Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_23143 details
Primary information
SALIDSAL_23143
Biomarker namehsa-miR-31
Biomarker TypeDiagnostic
Sampling MethodThe saliva from nine patients was collected in the week prior to operation and 6 weeks after operation in 2009. The saliva collected from eight normal individuals was used as control.
Collection Method5ml of saliva was collected from the floor of mouth after cleaning of oral cavity by mouth rinsing and saliva samples were centrifuged and supernatant phase of whole saliva was collected
Analysis MethodqRT-PCR
Collection SiteSupernatant Saliva
Disease CategoryCancer
Disease/ConditionOral Cancer
Disease SubtypeOral squamous cell carcinoma (OSCC)
Fold Change/ ConcentrationNA
Up/DownregulatedUpregulated
ExosomalNA
OrganismHomo sapiens
PMID20233326
Year of Publication2010
Biomarker IDhsa-miR-31
Biomarker CategorymiRNA
SequenceGGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC
Title of studyIncrease of microRNA miR-31 level in plasma could be a potential marker of oral cancer
Abstract of studyBACKGROUNDS: Oral squamous cell carcinoma (OSCC) is a worldwide disease. MicroRNAs are endogenously expressed non-coding RNAs that have important biological and pathological functions. miR-31 was found markedly up-regulated in OSCC and several other malignancies. However, miR-31 expression was also down-regulated in the metastasis process of breast carcinoma.MATERIALS AND METHODS: Using quantitative RT-PCR analysis, we identified plasma miR-31 in OSCC patients (n = 43) and case controlled individuals (n = 21). Nine OSCC patients saliva were also analyzed. The Mann-Whitney test and Wilcoxon matched pairs test were used to compare the differences among the various clinical variants.RESULTS: miR-31 in plasma was significantly elevated in OSCC patients relative to age and sex-matched control individuals. This marker yielded a receiver operating characteristic curve area of 0.82 and an accuracy of 0.72 defined by leave-one-out cross-validation. In addition, the plasma miR-31 in patients was remarkably reduced after tumor resection suggesting that this marker is tumor associated. Our preliminary analysis also demonstrated the feasibility of detecting the increase of miR-31 in patient's saliva.CONCLUSION: This study concluded that plasma miR-31 could be validated a marker of OSCC for diagnostic uses.