| Primary information |
|---|
| SALID | SAL_23042 |
| Biomarker name | hsa-miR-188 |
| Biomarker Type | Diagnostic |
| Sampling Method | OSCC patients and healthy controls of similar age, gender, ethnicity, and smoking history |
| Collection Method | Saliva samples were extracted using the mirVana miRNA Isolation Kit according to the manufacturers guideline. All of the saliva samples were kept at -80 degree C at all times |
| Analysis Method | qRT-PCR |
| Collection Site | Supernatant Saliva |
| Disease Category | Cancer |
| Disease/Condition | Oral Cancer |
| Disease Subtype | Oral Squamous Cell Carcinoma (OSCC) |
| Fold Change/ Concentration | NA |
| Up/Downregulated | NA |
| Exosomal | Exosomal |
| Organism | Homo sapiens |
| PMID | 19706812 |
| Year of Publication | 2009 |
| Biomarker ID | hsa-miR-188 |
| Biomarker Category | miRNA |
| Sequence | UGCUCCCUCUCUCACAUCCCUUGCAUGGUGGAGGGUGAGCUUUCUGAAAACCCCUCCCACAUGCAGGGUUUGCAGGAUGGCGAGCC |
| Title of study | Salivary microRNA: discovery, characterization, and clinical utility for oral cancer detection |
| Abstract of study | PURPOSE: We have previously shown that a transcriptome is found in saliva and subpanels of these mRNAs can be used as oral cancer biomarkers. In this study, we measured the presence of microRNAs (miRNA) in saliva and determined their potential as an additional set of oral cancer biomarkers.EXPERIMENTAL DESIGN: A total of 314 miRNAs were measured using reverse transcriptase-preamplification-quantitative PCR in 12 healthy controls. Degradation pattern of endogenous and exogenous saliva miRNAs were measured at room temperature over time. Selected miRNAs were validated in saliva of 50 oral squamous cell carcinoma patients and 50 healthy matched control subjects.RESULTS: We detected approximately 50 miRNAs in both the whole and supernatant saliva. Endogenous saliva miRNA degraded much slower compared with exogenous miRNA. Two miRNAs, miR-125a and miR-200a, were present in significantly lower levels (P < 0.05) in the saliva of oral squamous cell carcinoma patients than in control subjects.CONCLUSIONS: Both whole and supernatant saliva of healthy controls contained dozens of miRNAs, and similar to saliva mRNAs, these miRNAs are stable. Saliva miRNAs can be used for oral cancer detection. |