Detailed description page of SalivaDB

This page displays user query in tabular form.

SAL_23010 details
Primary information
SALIDSAL_23010
Biomarker namehsa-miR-100
Biomarker TypeDiagnostic
Sampling MethodOSCC patients and healthy controls of similar age, gender, ethnicity, and smoking history
Collection MethodSaliva samples were extracted using the mirVana miRNA Isolation Kit according to the manufacturers guideline. All of the saliva samples were kept at -80 degree C at all times
Analysis MethodqRT-PCR
Collection SiteWhole Saliva
Disease CategoryCancer
Disease/ConditionOral Cancer
Disease SubtypeOral Squamous Cell Carcinoma (OSCC)
Fold Change/ ConcentrationNA
Up/DownregulatedNA
ExosomalExosomal
OrganismHomo sapiens
PMID19706812
Year of Publication2009
Biomarker IDhsa-miR-100
Biomarker CategorymiRNA
SequenceCCUGUUGCCACAAACCCGUAGAUCCGAACUUGUGGUAUUAGUCCGCACAAGCUUGUAUCUAUAGGUAUGUGUCUGUUAGG
Title of studySalivary microRNA: discovery, characterization, and clinical utility for oral cancer detection
Abstract of studyPURPOSE: We have previously shown that a transcriptome is found in saliva and subpanels of these mRNAs can be used as oral cancer biomarkers. In this study, we measured the presence of microRNAs (miRNA) in saliva and determined their potential as an additional set of oral cancer biomarkers.EXPERIMENTAL DESIGN: A total of 314 miRNAs were measured using reverse transcriptase-preamplification-quantitative PCR in 12 healthy controls. Degradation pattern of endogenous and exogenous saliva miRNAs were measured at room temperature over time. Selected miRNAs were validated in saliva of 50 oral squamous cell carcinoma patients and 50 healthy matched control subjects.RESULTS: We detected approximately 50 miRNAs in both the whole and supernatant saliva. Endogenous saliva miRNA degraded much slower compared with exogenous miRNA. Two miRNAs, miR-125a and miR-200a, were present in significantly lower levels (P < 0.05) in the saliva of oral squamous cell carcinoma patients than in control subjects.CONCLUSIONS: Both whole and supernatant saliva of healthy controls contained dozens of miRNAs, and similar to saliva mRNAs, these miRNAs are stable. Saliva miRNAs can be used for oral cancer detection.