Primary information |
---|
SALID | SAL_22983 |
Biomarker name | hsa-miR-222 |
Biomarker Type | NA |
Sampling Method | 10 patients were at tumor stage I, 14 were at stage II, 16 were at stage III, and 10 were at stage IV. The average age of OSCC volunteers was 75 |
Collection Method | 400 microL of the whole saliva mixture (200 micrL whole saliva and 200 microL RNA later) and 400 microL of the supernatant saliva used for RNA extraction |
Analysis Method | RT-preamp-qPCR |
Collection Site | Supernatant Saliva |
Disease Category | Healthy |
Disease/Condition | Healthy |
Disease Subtype | NA |
Fold Change/ Concentration | NA |
Up/Downregulated | NA |
Exosomal | NA |
Organism | Homo sapiens |
PMID | 19706812 |
Year of Publication | 2009 |
Biomarker ID | hsa-miR-222 |
Biomarker Category | miRNA |
Sequence | GCUGCUGGAAGGUGUAGGUACCCUCAAUGGCUCAGUAGCCAGUGUAGAUCCUGUCUUUCGUAAUCAGCAGCUACAUCUGGCUACUGGGUCUCUGAUGGCAUCUUCUAGCU |
Title of study | Salivary microRNA: discovery, characterization, and clinical utility for oral cancer detection |
Abstract of study | PURPOSE: We have previously shown that a transcriptome is found in saliva and subpanels of these mRNAs can be used as oral cancer biomarkers. In this study, we measured the presence of microRNAs (miRNA) in saliva and determined their potential as an additional set of oral cancer biomarkers.EXPERIMENTAL DESIGN: A total of 314 miRNAs were measured using reverse transcriptase-preamplification-quantitative PCR in 12 healthy controls. Degradation pattern of endogenous and exogenous saliva miRNAs were measured at room temperature over time. Selected miRNAs were validated in saliva of 50 oral squamous cell carcinoma patients and 50 healthy matched control subjects.RESULTS: We detected approximately 50 miRNAs in both the whole and supernatant saliva. Endogenous saliva miRNA degraded much slower compared with exogenous miRNA. Two miRNAs, miR-125a and miR-200a, were present in significantly lower levels (P < 0.05) in the saliva of oral squamous cell carcinoma patients than in control subjects.CONCLUSIONS: Both whole and supernatant saliva of healthy controls contained dozens of miRNAs, and similar to saliva mRNAs, these miRNAs are stable. Saliva miRNAs can be used for oral cancer detection. |