Please wait...
| ID | PMID | YEAR | Sequence | Name | Length | N-ter MOD | C-ter MOD | Linear/Cyclic | Chirality | Chem-MOD | Origin | Nature | Incubation Time | Concentration | Half Life | Units Half Life | Protease | Assay | Test Sample | Vivo/Vitro | Reference | Patent No. | Activity |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 10541299 | 1999 | Novel erythropoiesis stimulating protein (NESP) | 166 | Free | Free | Cyclic | L | Five N-linked carbohydrate chains | Hyperglycosylated analogue of recombinant human erythropoietin | Stimulates erythropoiesis | Not mentioned | Not mentioned | 25.3 ±2.2 | Human blood proteases | ELISA | Subcutaneously injected into patients with end-stage renal failure | in vivo | http://www.drugbank.ca/drugs/DB00017 | None | Not reported | |||
| 21244372 | 2010 | PB-106 (ExC39PEG20kDa) | 39 | Free | Amidation | Linear | L | 20 kDa PEG at Cys at 39th position | Analogue of exenatide | Regulate blood glucose | Not mentioned | 5 µg ·mL-1 ·kg-1 | 49.4 ±7.7 | Rat plasma proteases | ELISA | Intravenously injected into Sprague-Dawley rats at a dose of 5 µg ·mL-1 ·kg-1 | in vivo | None | None | EC50 of 1.2nM for stimulation of intracellular cAMP in PC12 cells | |||
| 21244372 | 2010 | PB-107 (ExC39PEG30kDa) | 39 | Free | Amidation | Linear | L | 30 kDa PEG at Cys at 39th position | Analogue of exenatide | Regulate blood glucose | Not mentioned | 5 µg ·mL-1 ·kg-1 | 70.5 ±2.6 | Rat plasma proteases | ELISA | Intravenously injected into Sprague-Dawley rats at a dose of 5 µg ·mL-1 ·kg-1 | in vivo | None | None | EC50 of 14.2nM for stimulation of intracellular cAMP in PC12 cells | |||
| 21244372 | 2010 | PB-108 (ExC39PEG40kDa) | 39 | Free | Amidation | Linear | L | 40 kDa PEG at Cys at 39th position | Analogue of exenatide | Regulate blood glucose | Not mentioned | 5 µg ·mL-1 ·kg-1 | 76.4 ±7.4 | Rat plasma proteases | ELISA | Intravenously injected into Sprague-Dawley rats at a dose of 5 µg ·mL-1 ·kg-1 | in vivo | None | None | EC50 of 114.1nM for stimulation of intracellular cAMP in PC12 cells | |||
| 21114599 | 2010 | [Aib8,35]hGLP-1(7-36)NH2 | 30 | Free | Amidation | Linear | L | Aib--Aminoisobutyric acid | Analogue of glucagon like peptide1 | Regulate blood glucose | Not mentioned | Not mentioned | 66 | Human plasma proteases | HPLC | Human plasma | in vitro | 14759771 | None | EC50=0.06 ±0.04nM for cAMP stimulation | |||
| 20587645 | 2010 | PEG20k-HM-3 | 16 | Methoxy-polyethylene glycol-Succinimidyl Carbonate (SC-mPEG, molecular weight 20 kDa, named SC-mPEG20k ) | Free | Linear | L | None | HM-3 analogue | Anti-angiogenetic | Not mentioned | Not mentioned | >132 | SD rat plasma proteases | RP-HPLC | SD rat plasma | in vitro | http://pubs.rsc.org/En/content/articlepdf/2014/tb/ | None | 44.35% inhibitory effect on mouse tumors | |||
| 20593470 | 2010 | Peptide 7 | 41 | Free | Amidation | Linear | L | tBu=tertiary butyl | Synthetic dipeptide extended GLP-analogs | Regulate blood glucose | 168 hours | Not mentioned | >168 | None | HPLC | PBS | in vitro | None | None | Not reported | |||
| 20593470 | 2010 | Peptide 14 | 41 | Free | Amidation | Linear | L | None | Synthetic dipeptide extended GLP-analogs | Regulate blood glucose | 168 hours | Not mentioned | 33.3 | None | HPLC | PBS | in vitro | None | None | Not reported | |||
| 20593470 | 2010 | Peptide 16 | 41 | Free | Amidation | Linear | L | None | Synthetic dipeptide extended GLP-analogs | Regulate blood glucose | 168 hours | Not mentioned | >168 | None | HPLC | PBS | in vitro | None | None | Not reported | |||
| 20593470 | 2010 | Peptide 17 | 41 | Free | Amidation | Linear | L | None | Synthetic dipeptide extended GLP-analogs | Regulate blood glucose | 168 hours | Not mentioned | 50.6 | None | HPLC | PBS | in vitro | None | None | EC50=0.04 ±0.06nM | |||
| 20593470 | 2010 | Peptide 18 | 41 | Free | Amidation | Linear | L | None | Synthetic dipeptide extended GLP-analogs | Regulate blood glucose | 168 hours | Not mentioned | 64 | None | HPLC | PBS | in vitro | None | None | EC50=2.07 ±0.41nM | |||
| 16586064 | 2006 | N-PEG/GLP-1 | 30 | Free | Amidation | Linear | L | Pegylation at N terminus His7 | Synthetically synthesized Glucagon-like peptide-1 analogues | Insulinotropic | Not reported | Not mentioned | 7560 ±5635 | Rat plasma proteases | RP-HPLC | Rat plasma | in vitro | 16505481 | None | 290 ([pmol/l] islet-1 h-1) insulin release at -7 (log [mol/l]) | |||
| 16586064 | 2006 | Lys-PEG/GLP-1 | 30 | Free | Amidation | Linear | L | Pegylation on Lys34 | Synthetically synthesized Glucagon-like peptide-1 analogues | Insulinotropic | Not reported | Not mentioned | 4471 ±1822 | Rat plasma proteases | RP-HPLC | Rat plasma | in vitro | 16505481 | None | 150 ([pmol/l] islet-1 h-1) insulin release at -7 (log [mol/l]) | |||
| 16892368 | 2006 | C46 | 13 | Glycosylation | Amidation | Linear | L | None | Derived from T20 | HIV-1 fusion inhibitory peptide | Not reported | 40 ng peptide/200 mL plasma | 4.75 | Mouse plasma proteases | ELISA | Mouse plasma | in vitro | None | None | IC50=90nM | |||
| 16892368 | 2006 | C46 | 13 | Glycosylation | Amidation | Linear | L | None | Derived from T20 | HIV-1 fusion inhibitory peptide | Not reported | 41 ng peptide/200 mL plasma | 2 | Rat plasma proteases | ELISA | Rat plasma | in vitro | None | None | IC50=90nM | |||
| 16892368 | 2006 | Dimeric C46 | 26 | Glycosylation | Amidation | Linear | L | None | Derived from T20 | HIV-1 fusion inhibitory peptide | Not reported | 40 ng peptide/200 mL plasma | 1.75 | Mouse plasma proteases | ELISA | Mouse plasma | in vitro | None | None | Not given | |||
| 16892368 | 2006 | Dimeric C46 | 26 | Glycosylation | Amidation | Linear | L | None | Derived from T20 | HIV-1 fusion inhibitory peptide | Not reported | 40 ng peptide/200 mL buffer | 4.25 | Not mentioned | ELISA | PBS/1% BSA | in vitro | None | None | Not given | |||
| 17640899 | 2007 | T-291022 | 38 | Free | Free | Linear | L | None | Synthetic peptide | Antiviral peptide | Not reported | ~1 €“2mg/kg | 28.6 | Monkey blood proteases | RP-HPLC and ESI-MS | Male cynomolgus monkey blood plasma (Intravenous) | in vivo | None | None | IC50=0.022 µg/ml against IIIB virus | |||
| 17640899 | 2007 | T-291022 | 38 | Free | Free | Linear | L | None | Synthetic peptide | Antiviral peptide | Not reported | ~1 €“2mg/kg | 28.6 | Monkey blood proteases | RP-HPLC and ESI-MS | Male cynomolgus monkey blood plasma (Intravenous) | in vivo | None | None | IC50=0.049 µg/ml against 098 virus | |||
| 17640899 | 2007 | T-291022 | 38 | Free | Free | Linear | L | None | Synthetic peptide | Antiviral peptide | Not reported | ~1 €“2mg/kg | 28.6 | Monkey blood proteases | RP-HPLC and ESI-MS | Male cynomolgus monkey blood plasma (Intravenous) | in vivo | None | None | IC50=0.093 µg/ml against 098-T20 virus | |||
| 17640899 | 2007 | T-291022 | 38 | Free | Free | Linear | L | None | Synthetic peptide | Antiviral peptide | Not reported | ~1 €“2mg/kg | 28.6 | Monkey blood proteases | RP-HPLC and ESI-MS | Male cynomolgus monkey blood plasma (Intravenous) | in vivo | None | None | IC50=0.046 µg/ml against 098-T1249 virus | |||
| 17640899 | 2007 | T-291022 | 38 | Free | Free | Linear | L | None | Synthetic peptide | Antiviral peptide | Not reported | ~1 €“2mg/kg | 28.6 | Monkey blood proteases | RP-HPLC and ESI-MS | Male cynomolgus monkey blood plasma (Intravenous) | in vivo | None | None | IC50=0.242 µg/ml against 098-T651 virus | |||
| 17640899 | 2007 | T-267228 | 38 | Free | Free | Linear | L | None | Synthetic peptide | Antiviral peptide | Not reported | ~1 €“2mg/kg | 30.8 | Monkey blood proteases | RP-HPLC and ESI-MS | Male cynomolgus monkey blood plasma (Intravenous) | in vivo | None | None | IC50=0.172 µg/ml against IIIB virus | |||
| 17640899 | 2007 | T-267228 | 38 | Free | Free | Linear | L | None | Synthetic peptide | Antiviral peptide | Not reported | ~1 €“2mg/kg | 30.8 | Monkey blood proteases | RP-HPLC and ESI-MS | Male cynomolgus monkey blood plasma (Intravenous) | in vivo | None | None | IC50=0.600 µg/ml against 098 virus | |||
| 17640899 | 2007 | T-267228 | 38 | Free | Free | Linear | L | None | Synthetic peptide | Antiviral peptide | Not reported | ~1 €“2mg/kg | 30.8 | Monkey blood proteases | RP-HPLC and ESI-MS | Male cynomolgus monkey blood plasma (Intravenous) | in vivo | None | None | IC50=0.416 µg/ml against 098-T20 virus | |||
| 17640899 | 2007 | T-267228 | 38 | Free | Free | Linear | L | None | Synthetic peptide | Antiviral peptide | Not reported | ~1 €“2mg/kg | 30.8 | Monkey blood proteases | RP-HPLC and ESI-MS | Male cynomolgus monkey blood plasma (Intravenous) | in vivo | None | None | IC50=0.555 µg/ml against 098-T1249 virus | |||
| 17640899 | 2007 | T-267228 | 38 | Free | Free | Linear | L | None | Synthetic peptide | Antiviral peptide | Not reported | ~1 €“2mg/kg | 30.8 | Monkey blood proteases | RP-HPLC and ESI-MS | Male cynomolgus monkey blood plasma (Intravenous) | in vivo | None | None | IC50=0.987 µg/ml against 098-T651 virus | |||
| 17640899 | 2007 | T-267229 | 38 | Free | Free | Linear | L | None | Synthetic peptide | Antiviral peptide | Not reported | ~1 €“2mg/kg | 35.4 | Monkey blood proteases | RP-HPLC and ESI-MS | Male cynomolgus monkey blood plasma (Intravenous) | in vivo | None | None | IC50=3.162 µg/ml against IIIB virus | |||
| 17640899 | 2007 | T-267229 | 38 | Free | Free | Linear | L | None | Synthetic peptide | Antiviral peptide | Not reported | ~1 €“2mg/kg | 35.4 | Monkey blood proteases | RP-HPLC and ESI-MS | Male cynomolgus monkey blood plasma (Intravenous) | in vivo | None | None | IC50>20 µg/ml against 098 virus | |||
| 17640899 | 2007 | T-267229 | 38 | Free | Free | Linear | L | None | Synthetic peptide | Antiviral peptide | Not reported | ~1 €“2mg/kg | 35.4 | Monkey blood proteases | RP-HPLC and ESI-MS | Male cynomolgus monkey blood plasma (Intravenous) | in vivo | None | None | IC50>20 µg/ml against 098-T20 virus | |||
| 17640899 | 2007 | T-267229 | 38 | Free | Free | Linear | L | None | Synthetic peptide | Antiviral peptide | Not reported | ~1 €“2mg/kg | 35.4 | Monkey blood proteases | RP-HPLC and ESI-MS | Male cynomolgus monkey blood plasma (Intravenous) | in vivo | None | None | IC50>20 µg/ml against 098-T1249 virus | |||
| 17640899 | 2007 | T-267229 | 38 | Free | Free | Linear | L | None | Synthetic peptide | Antiviral peptide | Not reported | ~1 €“2mg/kg | 35.4 | Monkey blood proteases | RP-HPLC and ESI-MS | Male cynomolgus monkey blood plasma (Intravenous) | in vivo | None | None | IC50>20 µg/ml against 098-T651 virus | |||
| 17994612 | 2007 | Exendin-4 (Ex-4) | 39 | Free | Free | Linear | L | None | Salivary gland of the lizard Heloderma suspectum | Glucose-dependent insulin secretion, suppresses inappropriately elevated glucagon secretion, and slows down gastric emptying | Not reported | 4.0 mg/kg | 56.7 | Not mentioned | Radioimmunoassay | Monkey (Intravenous injection) | in vivo | None | None | Not given | |||
| 17994612 | 2007 | Exendin-4 (Ex-4) | 39 | Free | Free | Linear | L | None | Salivary gland of the lizard Heloderma suspectum | Glucose-dependent insulin secretion, suppresses inappropriately elevated glucagon secretion, and slows down gastric emptying | Not reported | 4.0 mg/kg | 77.4 | Not mentioned | Radioimmunoassay | Monkey (Subcutaneous injection) | in vivo | None | None | CL/F =2.0 ml/h/kg | |||
| 18307313 | 2007 | CAP 9 | 2 | Free | Y= structure given in paper | Linear | L | BIP | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 35 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC= 7 µM for S.aureus | |||
| 18307313 | 2007 | CAP 9 | 2 | Free | Y= structure given in paper | Linear | L | BIP | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 35 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC= 7 µM for Methicillin- resistant S.aureus | |||
| 18307313 | 2007 | CAP 9 | 2 | Free | Y= structure given in paper | Linear | L | Bip | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 35 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC= 6 µM for Methicillin- resistant S.epidermis | |||
| 18307313 | 2007 | CAP 12 | 2 | Free | Y= structure given in paper | Linear | L | Bip | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 30 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC= 8 µM for S.aureus | |||
| 18307313 | 2007 | CAP 12 | 2 | Free | Y= structure given in paper | Linear | L | Bip | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 30 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC= 8 µM for Methicillin- resistant S.aureus | |||
| 18307313 | 2007 | CAP 12 | 2 | Free | Y= structure given in paper | Linear | L | Bip | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 30 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC= 5 µM for Methicillin- resistant S.epidermis | |||
| 18307313 | 2007 | CAP 18 | 2 | Free | CH2CH2Ph | Linear | L | X= structure given in paper | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 30 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC= 4 µM for S.aureus | |||
| 18307313 | 2007 | CAP 18 | 2 | Free | CH2CH2Ph | Linear | L | X= structure given in paper | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 30 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC<3 µM for Methicillin- resistant S.aureus | |||
| 18307313 | 2007 | CAP 18 | 2 | Free | CH2CH2Ph | Linear | L | X= structure given in paper | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 30 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC<3 µM for Methicillin- resistant S.epidermis | |||
| 18307313 | 2007 | CAP 18 | 2 | Acetylation | Y= structure given in paper | Linear | L | Bip | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 30 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC= 4 µM for S.aureus | |||
| 18307313 | 2007 | CAP 18 | 2 | Acetylation | Y= structure given in paper | Linear | L | Bip | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 30 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC<3 µM for Methicillin- resistant S.aureus | |||
| 18307313 | 2007 | CAP 18 | 2 | Acetylation | Y= structure given in paper | Linear | L | Bip | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 30 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC<3 µM for Methicillin- resistant S.epidermis | |||
| 18307313 | 2007 | CAP 21 | 2 | Free | Amidation | Linear | L | X= structure given in paper | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 116 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC>100 µM for S.aureus | |||
| 18307313 | 2007 | CAP 21 | 2 | Free | Amidation | Linear | L | X= structure given in paper | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 116 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC>100 µM for Methicillin- resistant S.aureus | |||
| 18307313 | 2007 | CAP 21 | 2 | Free | Amidation | Linear | L | X= structure given in paper | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 116 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC>100 µM for Methicillin- resistant S.epidermis | |||
| 18307313 | 2007 | CAP 23 | 2 | Free | Amidation | Linear | L | X= structure given in paper | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 67 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC= 25 µM for S.aureus | |||
| 18307313 | 2007 | CAP 23 | 2 | Free | Amidation | Linear | L | X= structure given in paper | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 67 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC= 25 µM for Methicillin- resistant S.aureus | |||
| 18307313 | 2007 | CAP 23 | 2 | Free | Amidation | Linear | L | X= structure given in paper | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 67 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC= 5 µM for Methicillin- resistant S.epidermis | |||
| 18307313 | 2007 | CAP 25 | 2 | Free | Amidation | Linear | L | X= structure given in paper | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 88 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC>100 µM for S.aureus | |||
| 18307313 | 2007 | CAP 25 | 2 | Free | Amidation | Linear | L | X= structure given in paper | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 88 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC>100 µM for Methicillin- resistant S.aureus | |||
| 18307313 | 2007 | CAP 25 | 2 | Free | Amidation | Linear | L | X= structure given in paper | Synthetic peptide | Antimicrobial | Not reported | 1 mg/mL | 88 | Trypsin | RP-HPLC | Trypsin | in vitro | None | None | MIC>100 µM for Methicillin- resistant S.epidermis | |||
| 19053766 | 2008 | CGRP(8-37)-NH2 derivative 32 | 30 | Acetylation | Amidation | Linear | L | None | Calcitonin gene-related peptide | Neuropeptide | Not reported | 10 µg/ml | 38 | Monkey plasma proteases | ELISA | Monkey plasma | in vitro | None | None | IC50=3.57 ± 0.04 nM | |||
| 19053766 | 2008 | CGRP(8-37)-NH2 derivative 32 | 30 | Acetylation | Amidation | Linear | L | None | Calcitonin gene-related peptide | Neuropeptide | Not reported | 10 µg/ml | 68 | Human plasma proteases | ELISA | Human plasma | in vitro | None | None | IC50=3.57 ± 0.04 nM | |||
| 19552923 | 2011 | GLP-1-Tf | 30 | Human transferrin protein | Amidation | Linear | L | None | Proglucagon molecule | Insulinomimetic and insulinotropic | Not reported | 27.9 ± 5.8 μg/ml | 27 | Rabbit blood proteases | ELISA | Rabbit serum (Intravenous injection) | in vivo | None | None | Not available | |||
| 21664938 | 2011 | GLP715a | 46 | Free | Free | Linear | L | None | Proglucagon molecule | Anti-hyperglycemic hormone | Not reported | 300 μg/kg | 48 | Rat blood proteases | ELISA | Serum of rats (Subcutaneous injection) | in vivo | None | None | Binding constants to the GLP-1 receptor= 6.18 ± 1.27nM | |||
| 23318685 | 2013 | Peginesatide | 40 | Acetylation | Dimerization using PEGylation | Cyclic (C6-C15, C26-C35) | L | Nal, Pegylation | Synthetic peptide | Erythropoiesis-stimulating agent | Not reported | 0.5 mg/kg | 34.0 ± 5.9 | Monkey blood proteases | ELISA | Monkey blood plasma | in vitro | None | None | Increase in RBCs of 1.67 106/ µl 21 days after the administration | |||
| 23318685 | 2013 | Peginesatide | 40 | Acetylation | Dimerization using PEGylation | Cyclic (C6-C15, C26-C35) | L | Nal, Pegylation | Synthetic peptide | Erythropoiesis-stimulating agent | Not reported | 5 mg/kg | 99.0 ± 37.1 | Monkey blood proteases | ELISA | Monkey blood plasma | in vitro | None | None | Increase in RBCs of 1.67 106/ µl 21 days after the administration | |||
| 23318685 | 2013 | Peginesatide | 40 | Acetylation | Dimerization using PEGylation | Cyclic (C6-C15, C26-C35) | L | Nal, Pegylation | Synthetic peptide | Erythropoiesis-stimulating agent | Not reported | 5[C14] mg/kg | 84.0 ± 9.56 | Monkey blood proteases | ELISA | Monkey blood plasma | in vitro | None | None | Increase in RBCs of 1.73 106/ µl 21 days after the administration | |||
| N.A. | 2009 | Human Serum Albumin-DX-890 | 56 | Human serum albumin | Free | Linear | L | None | Kunitz domain peptide | Protease inhibitor | N.A. | Not mentioned | 3500 | Rabbit blood proteases | I-125 radiolabelling method | Rabbit plasma (Intravenous) | in vivo | None | EP2090589A1 | Inhibition constt (Ki) 7 ±1 pM | |||
| 15817669 | 2007 | Derivative of Growth hormone releasing factor | 30 | Free | Addition of maleimidopropionic acid (MPA) and amidation | Linear | Mix | None | GRF peptide | Growth harmone and somatostatin releasing factor | N.A. | 1microM/ Kg | 25.8 | Not mentioned | Radioimmunoassay | Rat plasma (Subcutaneous) | in vivo | None | US7268113B2 | Area under curve (AUC) for growth hormone (GH) release >10000 (ng/ml)*minute | |||
| 20503261 | 2001 | Val8-GLP-1-Fc | 31 | Free | Addition of Fc | Linear | L | None | Glucagon like peptide1 | Insulinotropic peptide | N.A. | 5.6 nM/ Kg | 45 | Monkey blood proteases | Radioimmunoassay | Monkey plasma (Intravenous) | in vivo | None | EP1355942B1 | Activation of GLP1 receptor (with respect to Val8-GLP-1(7-37)OH) 1.00% | |||
| 20503261 | 2001 | Val8-GLP-1-Human serum albumin (HSA) | 31 | Free | Human serum albumin | Linear | L | None | Glucagon like peptide1 | Insulinotropic peptide | N.A. | 5.6 nM/ Kg | 87 | Monkey blood proteases | Radioimmunoassay | Monkey plasma (Intravenous) | in vivo | None | EP1355942B1 | Not mentioned | |||
| 20503261 | 2001 | Gly8-Glu22-GLP-1-CEx-Linker-IgG1 | 31 | Free | Linking IgG1 using CEx-Linker (SSGAPPPS-GGGGSGGGGSGGGGS) | Linear | L | None | Glucagon like peptide1 | Insulinotropic peptide | N.A. | 0.1 mg/ Kg | 55 | Dog blood proteases | Radioimmunoassay | Dog plasma (Intravenous) | in vivo | None | EP1355942B1 | Activation of GLP1 receptor (with respect to Val8-GLP-1(7-37)OH) 150.00% | |||
| 20503261 | 2001 | Gly8-Glu22-GLP-1-CEx-Linker-IgG1 | 31 | Free | Linking IgG1 using CEx-Linker (SSGAPPPS-GGGGSGGGGSGGGGS) | Linear | L | None | Glucagon like peptide1 | Insulinotropic peptide | N.A. | 0.1 mg/ Kg | 38 | Not mentioned | Radioimmunoassay | Dog plasma (Subcutaneous) | in vivo | None | EP1355942B1 | Not mentioned | |||
| 20503261 | 2010 | GLP-1-PEG | 40 | Free | Addition of NH2-PEG at Cys40 | Linear | L | None | Glucagon like peptide1 | Insulinotropic peptide | N.A. | 0.1 mg/ Kg | 25.8 | Rat blood proteases | Radioimmunoassay | Rat plasma (Intravenous) | in vivo | None | EP1881850B1 | EC50= 0.36 nM | |||
| 20503261 | 2010 | GLP-1-PEG | 40 | Free | Addition of NH2-PEG at Cys40 | Linear | L | None | Glucagon like peptide1 | Insulinotropic peptide | N.A. | 0.1 mg/ Kg | 28.3 | Not mentioned | Radioimmunoassay | Rat plasma (Subcutaneous) | in vivo | None | EP1881850B1 | Not mentioned | |||
| 20503261 | 2010 | GLP-1-PEG | 40 | Free | Addition of NH2-PEG at Cys40 | Linear | L | None | Glucagon like peptide1 | Insulinotropic peptide | N.A. | 0.01 mg/ Kg | 75.69 | Not mentioned | Radioimmunoassay | Monkey plasma (Subcutaneous) | in vivo | None | EP1881850B1 | Not mentioned | |||
| N.A. | 2012 | V8E22I33C45-40kDa PEG | 39 | Free | Pegylation | Linear | L | None | Glucagon like peptide1 | Insulinotropic peptide | N.A. | 0.1 mg/ kg | 1.5 | Rat blood proteases | Radioimmunoassay | Rat plasma (Intravenous) | in vivo | None | EP1605897B1 | EC50= 9.4% with respect to Val8-GLP-1-OH | |||
| N.A. | 2012 | V8E22I33C45-40kDa PEG | 39 | Free | Pegylation | Linear | L | None | Glucagon like peptide1 | Insulinotropic peptide | N.A. | 0.1 mg/ Kg | 1.3 | Not mentioned | Radioimmunoassay | Rat plasma (Subcutaneous) | in vivo | None | EP1605897B1 | EC50= 9.4% with respect to Val8-GLP-1-OH | |||
| N.A. | 2012 | V8E22I33C45-40kDa PEG | 39 | Free | Pegylation | Linear | L | None | Glucagon like peptide1 | Insulinotropic peptide | N.A. | 0.1 mg/ Kg | 59.5 | Monkey blood proteases | Radioimmunoassay | Monkey plasma (Intravenous) | in vivo | None | EP1605897B1 | EC50= 9.4% with respect to Val8-GLP-1-OH | |||
| N.A. | 2012 | V8E22I33C45-40kDa PEG | 39 | Free | Pegylation | Linear | L | None | Glucagon like peptide1 | Insulinotropic peptide | N.A. | 0.1 mg/ Kg | 61.6 | Not mentioned | Radioimmunoassay | Monkey plasma (Subcutaneous) | in vivo | None | EP1605897B1 | EC50= 9.4% with respect to Val8-GLP-1-OH | |||
| N.A. | 2012 | Exendin-4(N)-PEG-Fc | 39 | Pegylation | Addition of Fc | Linear | L | None | Venom of Heloderma horridum | Insulinotropic peptide | N.A. | Not mentioned | 62 | Not mentioned | Not mentioned | blood | Not mentioned | None | EP2114438B1 | EC50= <0.2 % with respect to Exendin-4 | |||
| N.A. | 2012 | Exendin-4(Lys27)-PEG-Fc | 39 | Free | Addition of Fc | Linear | L | Pegylation at K27 | Venom of Heloderma horridum | Insulinotropic peptide | N.A. | Not mentioned | 61 | Not mentioned | Not mentioned | blood | Not mentioned | None | EP2114438B1 | EC50= 13.2 % with respect to Exendin-4 | |||
| N.A. | 2012 | DM exendin-4(Lys27)-PEG-Fc | 38 | Modification of His1 of Exendin-4 into dimethylhistidyl (DM) group | Addition of Fc | Linear | L | Pegylation at K27 | Venom of Heloderma horridum | Insulinotropic peptide | N.A. | Not mentioned | 69 | Not mentioned | Not mentioned | blood | Not mentioned | None | EP2114438B1 | EC50= 2.6 % with respect to Exendin-4 | |||
| N.A. | 2012 | DA exendin-4(Lys27)-PEG-Fc | 38 | Modification of His1 of Exendin-4 into desaminohistidyl (DA) group | Addition of Fc | Linear | L | Pegylation at K27 | Venom of Heloderma horridum | Insulinotropic peptide | N.A. | Not mentioned | 54 | Not mentioned | Not mentioned | blood | Not mentioned | None | EP2114438B1 | EC50= 13.2 % with respect to Exendin-4 | |||
| N.A. | 2012 | HY exendin-4(Lys27)-PEG-Fc | 38 | Modification of His1 of Exendin-4 into betahydroxylamidazolpropionyl (HY) | Addition of Fc | Linear | L | Pegylation at K27 | Venom of Heloderma horridum | Insulinotropic peptide | N.A. | Not mentioned | 52 | Not mentioned | Not mentioned | blood | Not mentioned | None | EP2114438B1 | EC50= 7.6 % with respect to Exendin-4 | |||
| N.A. | 2012 | CA exendin-4(Lys27)-PEG-Fc | 38 | Modification of His1 of Exendin-4 into imidazoacetyl (CA) group | Addition of Fc | Linear | L | Pegylation at K27 | Venom of Heloderma horridum | Insulinotropic peptide | N.A. | Not mentioned | 52 | Not mentioned | Not mentioned | blood | Not mentioned | None | EP2114438B1 | EC50= 8.5 % with respect to Exendin-4 | |||
| N.A. | 2012 | DA GLP-1 (Lys20,28)-PEG-Fc | 39 | Modification of His1 of Exendin-4 into desaminohistidyl (DA) group | Addition of Fc | Linear | L | Pegylation at K20 and K28 | Glucagon like peptide1 | Insulinotropic peptide | N.A. | Not mentioned | 27 | Not mentioned | Not mentioned | blood | Not mentioned | None | EP2114438B1 | EC50= 2 % with respect to Exendin-4 | |||
| 15369394 | 2004 | PEG40-FMS-IFNα2 | 146 | Pegylation [40kdaPEG linked to INFα2 via 2-sulfo-9-fluorenylmethoxycarbonyl (FMS)] | Free | Cyclic(C1-C98, C29-138) | L | None | IFNα2 derivative | Antiviral and antiproliferative | 0-150 hours | 10 µg | 65 (t1/2 of rate of regeneration of native interferon) | Rat blood proteases | BIAcore binding assay | Intravenously administered to wistar rats | in vivo | http://www.drugbank.ca/drugs/DB00105 | None | Following subcutaneous administration to rats and monitoring circulating antiviral activity, active IFNα2 levels peaked at 50 h, with substantial levels still being detected 200 h after administration. | |||
| 7418787 | 1979 | Lysine vasopressin | 9 | Free | Free | Cyclic (C1-C6) | L | None | Human Pituitary | Regulator of fluid and water balance | Not given | 0.2 mg | 47.4 (t1/2 of specific radioactivity) | None | Liquid scintillation spectrometer | Weakly acidic solution (pH 4.0, acetic acid) | in vitro | None | None | Not reported | |||
| 11778971 | 2001 | Glycosylated sms-14 | 14 | Dextran 70kDa conjugation | Free | Cyclic (C3-C14) | L | Glycosylation | Somatostatin derivative | Growth Hormone | 24 hours | 100 μl | 27 | Mice blood protease | HPLC | Subcutaneously injected in mice | in vivo | None | None | It inhibits tumor growth at IC50 ~2.5 nM | |||
| 16828890 | 2006 | NC-1900 (Analogue of arginine vasopressin) | 5 | Free | Addition of lycinamide | Linear | L | conjugated with cationic bovine serum albumin conjugated pegylated nanoparticles (CBSA-NPs), pGlu=pyroglutamic acid | Synthetic analogue of arginine vasopressin | Neuropeptide | 0.5, 1, 2, 3, 4, 6, 9, 12, 24, 36 and 48 h | 0.55mM | 78 | Mice blood proteases | HPLC-UV | Subcutaneously and Intravenously injected in mice | in vitro | None | None | The memory impairments were greatly improved, and then to normal when the mice were treated with NC-1900 loaded in CBSA-NPs | |||
| 16982323 | 2006 | Hematide | 42 | Acetylation | Beta-alanine-PEG | Linear | L | X1-Napthyl-alanine, X2-Sarcosine | Synthetic dimeric peptide | Erythropoiesis stimulating agent | Not mentioned | 6.9 mg/kg | 27.5 ±3.7 | Rat plasma proteases | Competitive ELISA | Rat plasma (Dose i/v adminstered) | in vivo | None | None | IC50 = 37pM for HuEPOr/125I-EPO competition binding assay, EC50 =460 pM for cell proliferation stimulation | |||
| 16982323 | 2006 | Hematide | 42 | Acetylation | Beta-alanine-PEG | Linear | L | X1-Napthyl-alanine, X2-Sarcosine | Synthetic dimeric peptide | Erythropoiesis stimulating agent | Not mentioned | 13.8 mg/kg | 30.7 ±2.6 | Rat plasma proteases | Competitive ELISA | Rat plasma (Dose i/v adminstered) | in vivo | None | None | IC50 = 37pM for HuEPOr/125I-EPO competition binding assay, EC50 =460 pM for cell proliferation stimulation | |||
| 16982323 | 2006 | Hematide | 42 | Acetylation | Beta-alanine-PEG | Linear | L | X1-Napthyl-alanine, X2-Sarcosine | Synthetic dimeric peptide | Erythropoiesis stimulating agent | Not mentioned | 9.87 mg/kg | 47.8 | Rat plasma proteases(rat chronic renal insufficiency (CRI) model) | Competitive ELISA | Rat(rat chronic renal insufficiency (CRI) model) plasma (Dose i/v adminstered) | in vivo | None | None | IC50 = 37pM for HuEPOr/125I-EPO competition binding assay, EC50 =460 pM for cell proliferation stimulation | |||
| 16982323 | 2006 | Hematide | 42 | Acetylation | Beta-alanine-PEG | Linear | L | X1-Napthyl-alanine, X2-Sarcosine | Synthetic dimeric peptide | Erythropoiesis stimulating agent | Not mentioned | 0.475 mg/kg | 29.9 ±9.4 | Monkey plasma proteases | Competitive ELISA | Monkey plasma (Dose i/v adminstered) | in vivo | None | None | IC50 = 37pM for HuEPOr/125I-EPO competition binding assay, EC50 =460 pM for cell proliferation stimulation | |||
| 16982323 | 2006 | Hematide | 42 | Acetylation | Beta-alanine-PEG | Linear | L | X1-Napthyl-alanine, X2-Sarcosine | Synthetic dimeric peptide | Erythropoiesis stimulating agent | Not mentioned | 1.35 mg/kg | 59.7 ±2.9 | Monkey plasma proteases | Competitive ELISA | Monkey plasma (Dose i/v adminstered) | in vivo | None | None | IC50 = 37pM for HuEPOr/125I-EPO competition binding assay, EC50 =460 pM for cell proliferation stimulation | |||
| 22186872 | 2011 | Vasopressin | 9 | Free | Amidation | Cyclic (C1-C6) | L | None | Anti-diuretic hormone secreted by pitutiary gland | Anti-diuretic and regulates retention of water | Room Temperature | 1mg/mL | >7 | Hydolytic activity of bacterial strain B-9 | HPLC and LC/ITMS | Bacterial strain B-9 cell culture | in vitro | None | None | Not reported | |||
| 25039358 | 2014 | Coumarin-modified GLP-1 derivative 7 | 30 | Free | Amidation | Linear | L | X-2 = Cys- conjugated-7-hydroxyCoumarin maleimide | Analog of human GLP-1 | Hypoglycaemic | 37 °C for 2-72 hours | 1000ng/ml | 52.2 | Rat plasma proteases | LC-MS/MS | Rat Plasma | in vitro | None | None | GLP-1 receptor Activation potency with EC50 = 18.6 ± 1.3 pM in HEK-293 cells | |||
| 25243635 | 2014 | VGLP1K3 (Glucagon like peptide 1 derivative) | 34 | Free | Free | Cyclic (C18-C26) | L | None | Glucagon Like protein-1 (GLP-1) | Antihyperglycemic | 37 °C for 0.1-24 hours | 500μg | <80 | DPP IV | ELISA | DPP IV | in vitro | None | None | Not reported | |||
| 25243635 | 2014 | VGLP1K6 (Glucagon like peptide 1 derivative) | 37 | Free | Free | Cyclic (C12-C20) | L | None | Glucagon Like protein-1 (GLP-1) | Antihyperglycemic | 37 °C for 0.1-24 hours | 500μg | ~ 70 | DPP IV | ELISA | DPP IV | in vitro | None | None | The insulin levels were increased dramatically to 906.53b ± 22.18pmol/L within 60 min after GLP-1 administration | |||
| 25243635 | 2014 | VGLP1K6 (Glucagon like peptide 1 derivative) | 37 | Free | Free | Cyclic (C12-C20) | L | None | Glucagon Like protein-1 (GLP-1) | Antihyperglycemic | 5-90 hours | 300μg/Kg body weight of rats | ~ 70 | Rat serum proteases | ELISA | Subcutaneously injected in Sprague ˆ’Dawley (SD) rats | in vivo | None | None | The insulin levels were increased dramatically to 906.53b ± 22.18pmol/L within 60 min after GLP-1 administration | |||
| 25900863 | 2015 | PEG-TRI-1144 | 38 | Acetylation | Amidation | Linear | L | Conjugated with PEG(40KDa) thro µgh Lys-30 | Synthetic derived from SPPS with an acetylated N-terminus and amidated C-terminus. | HIV-fusion inhibitor | Blood sample collected after 1-168 hours after the infusion of peptide | 800nmol/Kg dose injected | 34 | Rat plasma proteases | LC-MS/MS | Intravenously administered to Sprague €“Dawley rats | in vivo | None | None | Not reported | |||
| 25900863 | 2015 | PEG-TRI-1144 | 38 | Acetylation | Amidation | Linear | L | Conjugated with PEG(40KDa) thro µgh Lys-30 | Synthetic derived from SPPS with an acetylated N-terminus and amidated C-terminus. | HIV-fusion inhibitor | Not mentioned | Not mentioned | 70 | Human plasma proteases | LC-MS/MS | Human Plasma | in vivo | None | None | Not reported | |||
| 25900863 | 2015 | PEG40kDa[ClPhSO2]TRI-1144 | 38 | Acetylation | Amidation | Linear | L | Conjugated with ClPhSO2 conjugate thro µgh Lys-30 | Synthetic derived from SPPS with an acetylated N-terminus and amidated C-terminus. | HIV-fusion inhibitor | Not mentioned | Not mentioned | 150 (t1/2β) | Human plasma proteases | LC-MS/MS | Human Plasma | in vivo | None | None | Not reported | |||
| 25900863 | 2015 | PEG40kDa[ClPhSO2]TRI-1144 | 38 | Acetylation | Amidation | Linear | L | Conjugated with ClPhSO2 conjugate thro µgh Lys-30 | Synthetic derived from SPPS with an acetylated N-terminus and amidated C-terminus. | HIV-fusion inhibitor | Blood sample collected after 1-168 hours after the infusion of peptide | 800nmol/Kg dose injected | 150 (t1/2 linker cleavage) | Rat plasma proteases | LC-MS/MS | Intravenously administered to Sprague €“Dawley rats | in vivo | None | None | Not reported | |||
| 25900863 | 2015 | PEG40kDa[MorphSO2]TRI-1144 | 38 | Acetylation | Amidation | Linear | L | Conjugated with MorphSO2 conjugate thro µgh Lys-30 | Synthetic derived from SPPS with an acetylated N-terminus and amidated C-terminus. | HIV-fusion inhibitor | Blood sample collected after 1-168 hours after the infusion of peptide | 800nmol/Kg dose injected | 44 (t1/2β of releasable PEG-TRI-1144 conjugate) | Rat plasma proteases | LC-MS/MS | Intravenously administered to Sprague €“Dawley rats | in vivo | None | None | Not reported | |||
| 26222180 | 2015 | G36A or [GLP-1(7-36A)] | 30 | Free | Amidation | Linear | L | None | Glucagon-like peptide 1 (GLP-1) | Antihyperglycemic or incretin effect(Stimulate Insulin release in glucose dependent manner) | Room Temp and on Ice | 0.4 µM | >96 | Human plasma proteases + DPP IV | MS, ELISA | P700 plasma | in vitro | None | None | Not reported | |||
| 26222180 | 2015 | G36A or [GLP-1(7-36A)] | 30 | Free | Amidation | Linear | L | None | Glucagon-like peptide 1 (GLP-1) | Antihyperglycemic or incretin effect(Stimulate Insulin release in glucose dependent manner) | Room Temp and on Ice | 0.4 µM | >96 | Human plasma proteases + DPP IV | MS, ELISA | P800 plasma | in vitro | None | None | Not reported | |||
| 26222180 | 2015 | G36A or [GLP-1(7-36A)] | 30 | Free | Amidation | Linear | L | None | Glucagon-like peptide 1 (GLP-1) | Antihyperglycemic or incretin effect(Stimulate Insulin release in glucose dependent manner) | On ice | 0.4 µM | 37-96 | Human blood proteases + DPP IV | MS | P800 whole blood | in vitro | None | None | Not reported | |||
| 26222180 | 2015 | G 37 or [GLP-1(7 €“37)] | 31 | Free | Free | Linear | L | None | Glucagon-like peptide 1 (GLP-1) | Antihyperglycemic or incretin effect(Stimulate Insulin release in glucose dependent manner) | Room Temp | 0.4 µM | >96 | Human plasma proteases + DPP IV | MS, ELISA | P700 plasma | in vitro | None | None | Not reported | |||
| 26222180 | 2015 | G 37 or [GLP-1(7 €“37)] | 31 | Free | Free | Linear | L | None | Glucagon-like peptide 1 (GLP-1) | Antihyperglycemic or incretin effect(Stimulate Insulin release in glucose dependent manner) | Room Temp | 0.4 µM | >96 | Human plasma proteases + DPP IV | MS, ELISA | P800 plasma | in vitro | None | None | Not reported | |||
| 26222180 | 2015 | G 37 or [GLP-1(7 €“37)] | 31 | Free | Free | Linear | L | None | Glucagon-like peptide 1 (GLP-1) | Antihyperglycemic or incretin effect(Stimulate Insulin release in glucose dependent manner) | On ice | 0.4 µM | 41 ±5.0 | Human blood proteases + DPP IV | MS | P800 whole blood | in vitro | None | None | Not reported | |||
| 26222180 | 2015 | GIP (1-42) (Glucosedependent insulinotropic polypeptide) | 42 | Free | Free | Linear | L | None | Proprotein of gastrointestinal tract | Antihyperglycemic or incretin effect(Stimulate Insulin release in glucose dependent manner) | Room Temp | 0.4 µM | >96 | Human plasma proteases + DPP IV | MS | P800 plasma | in vitro | None | None | Not reported | |||
| 26222180 | 2015 | OXM(1-37) (Oxyntomodulin) | 37 | Free | Free | Linear | L | None | Peptide Hormone of colon | Anti-apetizer | Room Temp | 0.4 µM | >72 | Human plasma proteases + DPP IV | MS | P800 plasma | in vitro | None | None | Not reported | |||
| 26222180 | 2015 | Glucagon | 29 | Free | Free | Linear | L | None | Peptide hormone of pancrease | Regulates hypoglycemia | Room Temp | 0.4 µM | 45 | Human plasma proteases + DPP IV | MS | P800 plasma | in vitro | None | None | Not reported | |||
| 26308095 | 2015 | semaglutide | 36 | Free | Amidation | Linear | L | Alpha-aminoisobutyric acid at 8th position, Acylation of peptide at K-26 with C-18 fatty di-acid chain | Glucagon-like peptide 1 (GLP-1) analogue | Regulates blood glucose by upregulating the insulin secretion | Blood sample collected after7-288 hours after the injection of peptide | 1 -2 nmol/Kg | 165 | Human plasma proteases | ELISA, LC/MS | Human plasma (Dose s/c injected) | in vivo | 25475122 | None | Semaglutide was the most potent with an ED50 of < 2 nmol/kg | |||
| 26308095 | 2015 | semaglutide | 36 | Free | Amidation | Linear | L | Acylation of peptide at K-26 with C-18 fatty di-acid chain | Glucagon-like peptide 1 (GLP-1) analogue | Regulates blood glucose by upregulating the insulin secretion | Blood sample collected after 1-96 hours after the injection of peptide | 5nmol/Kg | 46 | Mini-pig plasma proteases | ELISA, LC/MS | Mini-pigs plasma (Dose s/c injected) | in vivo | 25475122 | None | Semaglutide was the most potent with an ED50 of < 2 nmol/kg | |||
| 25453979 | 2014 | MA(D-Leu-4)OB3 | 7 | Myristoylation | Free | Linear | Mix | None | Synthetic peptide amide with leptin-like activity | Regulate energy balance by inhibiting hunger | Not mentioned | Peptide was dissolved in 0.3% Intravail ® reconstituted in sterile deion-ized water at a concentratio | 28.9 | Mice serum proteases | Competitive ELISA | Male Swiss Webster mice serum (Oral route of delivery) | in vivo | None | None | Efficacy of MA-[D-Leu-4]-OB3 on blood glucose levels in db/dbmice following oral delivery in 0.3% DDM | |||
| 16266798 | 2005 | Spantide II (Neurokinin-1 receptor (NK-1R) antagonist) | 11 | Nicotinoylation | Amidation | Linear | Mix | Pal=3-(2-Pyridyl)-L-alanine , k(Nic)=Nicotinoyl)Lys , Nle=NorLeucine, Dichloro at 5th Phenyl | Neurokinin-1 receptor (NK-1R) antagonist | Anti-inflammatory | Not mentioned | 5mg/ml | 95 days at pH 3 at 60 C | None | HPLC, LC-MS | Ethanol -water mixture | in vitro | None | None | Not reported | |||
| 1904406 | 1991 | [Leu27] hGRF( 1-32)NH2 (Growth hormone releasing factor analog) | 32 | Free | Amidation | Linear | L | None | Human growth hormone releasing factor analog | Growth hormone(GH) release | 37 °C, phosphate buffer pH 7.4 | 0.2mM | 202 | Collagenase pancreatin | HPLC | Cultured bovine anterior pituitary cells | in vitro | None | None | EC50=0.24 ± 0.045(GH release) | |||
| 1904406 | 1991 | [Leu27, Asn28]hGRF(I-32)NH2 (Growth hormone releasing factor analog) | 32 | Free | Amidation | Linear | L | None | Human growth hormone releasing factor analog | Growth hormone(GH) release | 37 °C, phosphate buffer pH 7.4 | 0.2mM | 150 | Collagenase pancreatin | HPLC | Cultured bovine anterior pituitary cells | in vitro | None | None | EC50=0.32 ± 0.059(GH release) | |||
| 1904406 | 1991 | [Ser8, Leu27, Asn28]hGRF(I-32)NH2 (Growth hormone releasing factor analog) | 32 | Free | Amidation | Linear | L | None | Human growth hormone releasing factor analog | Growth hormone(GH) release | 37 °C, phosphate buffer pH 7.4 | 0.2mM | 746 | Collagenase pancreatin | HPLC | Cultured bovine anterior pituitary cells | in vitro | None | None | EC50=0.26 ± 0.040(GH release) | |||
| 1904406 | 1991 | [Ser8, Leu27]hGRF(I-32)NH2 (Growth hormone releasing factor analog) | 32 | Free | Amidation | Linear | L | None | Human growth hormone releasing factor analog | Growth hormone(GH) release | 37 °C, phosphate buffer pH 7.4 | 0.2mM | 1550 | Collagenase pancreatin | HPLC | Cultured bovine anterior pituitary cells | in vitro | None | None | EC50=0.44 ± 0.014(GH release) | |||
| 2298867 | 1990 | Antide(Nal-Lys) | 10 | Acetylation | Amidation | Linear | Mix | None | Nal-Lys GnRH antagonist | Regulates or inhibits LH release or gonadotropins | Blood collected upto 30 days after peptide injection | 3.5mg/kg injected i/v | 6.5 | Proteases from OVX monkey serum | Radioactive assay | (Dose i/v injected)OVX monkey Serum | in vivo | None | None | Gonadotropin inhibition;Following sc or iv Antide injection, peripheral Luteinizing hormone (LH) levels declined from 281 + 19 ng/ml to 29 + 3 ng/ml within one day | |||
| 2556215 | 1989 | Angiotensin I (AI) | 10 | Free | Free | Linear | L | None | Derived from angiotensin | Precusor of angiotensin- II (AII) | 37 °C | 100 - 2000 ng/ml | 44.6 | Fetal calf serum proteases | Radioimmunoassay | Primary endothelial cells + Fetal calf Serum (2.5%) + converting enzyme inhibitor (MK422) with conc 10-6 M | in vitro | None | None | Not mentioned | |||
| 26308095 | 2015 | Semaglutide | 31 | Free | Free | Linear | L | Aib =2-Aminoisobutyric acid; Acylation of peptide at K-26 with fatty acid side chain i.e. N6-[N-(17-carboxy-1-oxoheptadecyl-L-c-glutamyl[2- (2-aminoethoxy)ethoxy]acetyl[2-(2 aminoethoxy)ethoxy]acetyl | GLP-1 (Glucagon like peptide-1) analogue | Regulate blood glucose level | Blood samples collected upto 96 hous | 1 -2 nmol/Kg | 165 | Proteases from Human plasma | ELISA, LC/MS | (Dose s/c injected)Human plasma | in vivo | 23743288 | None | Semaglutide was the most potent to lower blood glucose with an ED50 of < 2 nmol/kg | |||
| 26308095 | 2015 | Semaglutide | 31 | Free | Free | Linear | L | Aib =2-Aminoisobutyric acid; Acylation of peptide at K-26 with fatty acid side chain i.e. N6-[N-(17-carboxy-1-oxoheptadecyl-L-c-glutamyl[2- (2-aminoethoxy)ethoxy]acetyl[2-(2 aminoethoxy)ethoxy]acetyl | GLP-1 (Glucagon like peptide-1) analogue | Regulate blood glucose level | Blood samples collected upto 96 hous | 5nmol/Kg | 46 | Proteases from mini-pig plasma | ELISA, LC/MS | (Dose i/v injected)Mini-pigs plasma | in vivo | 23743288 | None | Semaglutide was the most potent to lower blood glucose with an ED50 of < 2 nmol/kg | |||
| 1911217 | 1991 | CGRP (Calcitonin gene-related peptide) | 37 | Free | Amidation | Cyclic (C2-C7) | L | None | Alernative spliced product of calcitonon produced by thyroid gland | Vasodilator and cause tumor hypoxia | Not mentioned | 300-600pmol | 30 (biological half-life) | Not mentioned | Not mentioned | Human Plasma | in vivo | None | None | Not reported | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | 48 hours | 500μg/kg | 30.2 | Rats blood proteases | Radioimmunoassay | Intravenous injection of the peptide in Hans Wistar Female rat | in vivo | None | None | Platelet count increased from 1,504×103/mm3 to 2,262×103/mm3,Neutophil count increased from 941/mm3 to 19,802/mm3,Monocyte count increased from 160/mm3 to 7,917/mm3,Eosinophil count increased from 86/mm3 to 1067/mm3,Basophil count increased from 11/mm3 to 653/mm3,Lymphocyte count increased from 4,210/mm3 to 24,759/mm3,RBC count decreased form 7.05×106/mm3 to 5.56×106/mm3,Prothrombin time increased from 13.7 to 16.7 seconds. | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | Not reported | 10μg/kg | 37 | Monkey blood proteases | Radioimmunoassay | Intravenous injection in cynomolgus monkeys | in vivo | None | None | Not mentioned | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | Not reported | 2μg/kg | 68 | Monkey blood proteases | Radioimmunoassay | Subcutaneous injection in cynomolgus monkeys | in vivo | None | None | Not mentioned | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | Not reported | 10μg/kg | 47 | Monkey blood proteases | Radioimmunoassay | Subcutaneous injection in cynomolgus monkeys | in vivo | None | None | Not mentioned | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | Not reported | 25μg/kg | 45 | Monkey blood proteases | Radioimmunoassay | Subcutaneous injection in cynomolgus monkeys | in vivo | None | None | Not mentioned | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | Not reported | 100μg/kg | 45 | Monkey blood proteases | Radioimmunoassay | Subcutaneous injection in cynomolgus monkeys | in vivo | None | None | Not mentioned | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | Not reported | 2μg/kg | 39 | Monkey blood proteases | Radioimmunoassay | Subcutaneous injection in cynomolgus monkeys | in vivo | None | None | Not mentioned | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | Not reported | 10μg/kg | 45 | Monkey blood proteases | Radioimmunoassay | Subcutaneous injection in cynomolgus monkeys | in vivo | None | None | Not mentioned | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | 48 hours | 500μg/kg following dose 1 | 26.1 | Monkey blood proteases | Radioimmunoassay | Intravenous injection in cynomolgus male monkey | in vivo | None | None | Platelet count increased from 381×103/mm3 to 1,811×103/mm3,Neutophil count increased from 4,400/mm3 to 6,900/mm3,Monocyte count increased from 450/mm3 to 1,150/mm3,Eosinophil count increased from 150/mm3 to 450/mm3,Lymphocyte count increased from 5,900/mm3 to 9,400/mm3,RBC count decreased form 5.96×106/mm3 to 5.53×106/mm3,Prothrombin time increased from 19.8 to 21.2 seconds. | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | 48 hours | 500μg/kg following dose 1 | 25.4 | Monkey blood proteases | Radioimmunoassay | Intravenous injection in cynomolgus female monkey | in vivo | None | None | Platelet count increased from 381×103/mm3 to 1,811×103/mm3,Neutophil count increased from 4,400/mm3 to 6,900/mm3,Monocyte count increased from 450/mm3 to 1,150/mm3,Eosinophil count increased from 150/mm3 to 450/mm3,Lymphocyte count increased from 5,900/mm3 to 9,400/mm3,RBC count decreased form 5.96×106/mm3 to 5.53×106/mm3,Prothrombin time increased from 19.8 to 21.2 seconds. | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | 48 hours | 2000μg/kg following dose 1 | 33.8 | Monkey blood proteases | Radioimmunoassay | Intravenous injection in cynomolgus male monkey | in vivo | None | None | Platelet count increased from 381×103/mm3 to 2,405×103/mm3,Neutophil count increased from 4,400/mm3 to 5,700/mm3,Monocyte count increased from 450/mm3 to 1,550/mm3,Eosinophil count increased from 150/mm3 to 350/mm3,Lymphocyte count increased from 5,900/mm3 to 11,300/mm3,RBC count decreased form 5.96×106/mm3 to 5.87×106/mm3,Prothrombin time increased from 19.8 to 23.3 seconds. | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | 48 hours | 2000μg/kg following dose 1 | 24.2 | Monkey blood proteases | Radioimmunoassay | Intravenous injection in cynomolgus female monkey | in vivo | None | None | Platelet count increased from 381×103/mm3 to 2,405×103/mm3,Neutophil count increased from 4,400/mm3 to 5,700/mm3,Monocyte count increased from 450/mm3 to 1,550/mm3,Eosinophil count increased from 150/mm3 to 350/mm3,Lymphocyte count increased from 5,900/mm3 to 11,300/mm3,RBC count decreased form 5.96×106/mm3 to 5.87×106/mm3,Prothrombin time increased from 19.8 to 23.3 seconds. | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | 48 hours | 500μg/kg following dose 14 | 27.2 | Monkey blood proteases | Radioimmunoassay | Intravenous injection in cynomolgus male monkey | in vivo | None | None | Platelet count increased from 381×103/mm3 to 1,811×103/mm3,Neutophil count increased from 4,400/mm3 to 6,900/mm3,Monocyte count increased from 450/mm3 to 1,150/mm3,Eosinophil count increased from 150/mm3 to 450/mm3,Lymphocyte count increased from 5,900/mm3 to 9,400/mm3,RBC count decreased form 5.96×106/mm3 to 5.53×106/mm3,Prothrombin time increased from 19.8 to 21.2 seconds. | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | 48 hours | 500μg/kg following dose 14 | 32.7 | Monkey blood proteases | Radioimmunoassay | Intravenous injection in cynomolgus female monkey | in vivo | None | None | Platelet count increased from 381×103/mm3 to 1,811×103/mm3,Neutophil count increased from 4,400/mm3 to 6,900/mm3,Monocyte count increased from 450/mm3 to 1,150/mm3,Eosinophil count increased from 150/mm3 to 450/mm3,Lymphocyte count increased from 5,900/mm3 to 9,400/mm3,RBC count decreased form 5.96×106/mm3 to 5.53×106/mm3,Prothrombin time increased from 19.8 to 21.2 seconds. | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | 48 hours | 1000μg/kg following dose 14 | 44 | Monkey blood proteases | Radioimmunoassay | Intravenous injection in cynomolgus male monkey | in vivo | None | None | Platelet count increased from 381×103/mm3 to 2,820×103/mm3,Neutophil count increased from 4,400/mm3 to 7,300/mm3,Monocyte count increased from 450/mm3 to 1,550/mm3,Eosinophil count increased from 150/mm3 to 800/mm3,Lymphocyte count increased from 5,900/mm3 to 8,100/mm3,RBC count increased form 5.96×106/mm3 to 6.16×106/mm3,Prothrombin time increased from 19.8 to 21.7 seconds. | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | 48 hours | 1000μg/kg following dose 14 | 25.1 | Monkey blood proteases | Radioimmunoassay | Intravenous injection in cynomolgus female monkey | in vivo | None | None | Platelet count increased from 381×103/mm3 to 2,820×103/mm3,Neutophil count increased from 4,400/mm3 to 7,300/mm3,Monocyte count increased from 450/mm3 to 1,550/mm3,Eosinophil count increased from 150/mm3 to 800/mm3,Lymphocyte count increased from 5,900/mm3 to 8,100/mm3,RBC count increased form 5.96×106/mm3 to 6.16×106/mm3,Prothrombin time increased from 19.8 to 21.7 seconds. | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | 48 hours | 2000μg/kg following dose 14 | 39.3 | Monkey blood proteases | Radioimmunoassay | Intravenous injection in cynomolgus male monkey | in vivo | None | None | Platelet count increased from 381×103/mm3 to 2,405×103/mm3,Neutophil count increased from 4,400/mm3 to 5,700/mm3,Monocyte count increased from 450/mm3 to 1,550/mm3,Eosinophil count increased from 150/mm3 to 350/mm3,Lymphocyte count increased from 5,900/mm3 to 11,300/mm3,RBC count decreased form 5.96×106/mm3 to 5.87×106/mm3,Prothrombin time increased from 19.8 to 23.3 seconds. | |||
| 10606160 | 1999 | GW395058 | 29 | Pegylated with 20,000 mw PEG [CH30(CH2CH2O)nCH@CH2C=O] | Amidation | Linear (branched) | L | Npa-napthylalanine,Sar-sarcosine | AF15705(substituted thrombopoietin mimetic peptide) | Treatment of thrombocytopenia | 48 hours | 2000μg/kg following dose 14 | 31.3 | Monkey blood proteases | Radioimmunoassay | Intravenous injection in cynomolgus female monkey | in vivo | None | None | Platelet count increased from 381×103/mm3 to 2,405×103/mm3,Neutophil count increased from 4,400/mm3 to 5,700/mm3,Monocyte count increased from 450/mm3 to 1,550/mm3,Eosinophil count increased from 150/mm3 to 350/mm3,Lymphocyte count increased from 5,900/mm3 to 11,300/mm3,RBC count decreased form 5.96×106/mm3 to 5.87×106/mm3,Prothrombin time increased from 19.8 to 23.3 seconds. | |||
| 20687610 | 2010 | c[E18,K22]-c[E30,K34]GLP-1(7-36)-NH2 | 30 | Free | Amidation | Cyclic (Lactam bridge between E16-K20, E22-K26 and E30-K41) | L | None | Analog of GLP-1 | Diagnosis and treatment of diabetes | 24 hours | 100μM | >96 | Neutral endopeptidase 24.11 | HPLC | GLP-1 analogue (100 μM) was incubated with the recombinant human NEP 24.11 enzyme (1.0 μg/mL) in HEPES buffer (50 mM, pH 7.4, 50 mM NaCl) at 37 °C | in vitro | http://www.drugbank.ca/drugs/DB00133 | None | EC50=1.9nM,pEC50=8.7 ±0.14 | |||
| 20687610 | 2010 | c[E16,K20]-c[E22,K26]-c[E30,K34]GLP-1(7-36)-NH2 | 30 | Free | Amidation | Cyclic (Lactam bridge between E16-K20, E22-K26 and E30-K45) | L | None | Analog of GLP-1 | Diagnosis and treatment of diabetes | 24 hours | 100μM | >96 | Neutral endopeptidase 24.11 | HPLC | GLP-1 analogue (100 μM) was incubated with the recombinant human NEP 24.11 enzyme (1.0 μg/mL) in HEPES buffer (50 mM, pH 7.4, 50 mM NaCl) at 37 °C | in vitro | http://www.drugbank.ca/drugs/DB00137 | None | EC50=1.8nM,pEC50=8.7 ±0.09 | |||
| 21036718 | 2010 | 177Lu-AMBA | 9 | 177Lu,DO3A-CH2CO-G-(4-aminobenzoyl) | Amidation | Linear | L | None | Synthetic Bombesin like peptide | Clinical trials for use as systemic radiotherapy for hormone refractory prostate cancer (HRPC) patients. | Not mentioned | 10μg/mouse | 26.6 ±11.7(t1/2β) | Mice plasma proteases | Radio-HPLC | Intravenous injection in PC-3M-luc-C6 tumour-bearing mice | in vivo | http://www.drugbank.ca/drugs/DB00139 | None | In vitro stability =24.3 ±21.9% after 48 hours | |||
| 24133142 | 2013 | GLP2-2G-XTEN (Glucagon like peptide-2-2G-XTEN) | 34 | Free | Ahx-6-aminohexanoic acid, Mpa-3-maleimidopropionic acid conjugated to the amino group of Ahx,XTEN protein | Linear | L | None | Glucagon-like peptide 2 variant | Treatment of short bowel syndrome | Aliquots were collected at 0.08, 4, 8, 24, 48, 72, 96, 120 and 168 h | 2mg/kg of rats | 38.5 ±7.4 | Rats blood proteases | ELISA,RP-HPLC | Subcutaneous injection in female Sprague €“ Dawley strain rats | in vivo | http://www.drugbank.ca/drugs/DB00185 | None | GPCR Ca2+ flux mobilization assay, relative activity=1.43% | |||
| 38917331 | 2024 | Aptamer-split peptide conjugate | 34 | DBCO modified S10 at C terminus | DBCO modified S11 peptide at N terminus | Linear | L | Azide-modified aptamer fragments (5 SSA and 3 SSA) "TTAATTCTGGGGGAGCCTTTTGTGGGTAGGGTTTTGTGGGTAGGGCGGGTTGGTTTTCGGGTTGGTTTTGCCCCGGAGGAGGAATT" are conjugated with DBCO-modified peptides (S10 and S11) , DBCO = Dibenzocyclooctyne | Aptamer-peptide complex | Hetero modulator for split GFP in response to ATP | Samples were collected every 24 h for 7 days | 1 μM | 4 | C57Bl/6N Mice serum protease | Serum stability assay | C57BL/6N Mice serum | In Vitro | None | None | A shorter antisense DNA of 11 nucleotides (aptamer) showed an EC50 value of 238 μM | |||
| 38807146 | 2024 | TG103 | 62 | Free | Fc region of IgG joined through (CH2-CH3) IgD | Linear | L | GLP-1 dimerization | GLP-1 analogs | Antiobesity | Blood sampling time points:(1) Within 2 h before dosing on day 1 and day 8,(2) 6, 12, 24, 36, 48, 72, 96, 144 and 168 h (before dosing on day 15) after dosing on day 8 (3)Within 2 h before dosing on day 64, day 71 and day 78 (4)6, 12, 24, 36, 48, 72, 96, 144, 168, 336 and 504 h after dosing on day 78. | 15.0 mg | 116 ± 10.8 (Terminal Half Life) | Human serum protease | Double-antibody sandwich assay | Human serum | In Vivo | None | None | N.A. | |||
| 38807146 | 2024 | TG103 | 62 | Free | Fc region of IgG joined through (CH2-CH3) IgD | Linear | L | GLP-1 dimerization | GLP-1 analogs | Antiobesity | Blood sampling time points:(1) Within 2 h before dosing on day 1, day 8 and day 15, (2) 6, 12, 24, 36, 48, 72, 96, 144 and 168 h (before dosing on day 22) after dosing on day 15 (3)Within 2 h before dosing on day 64, day 71 and day 78 (4) 6, 12, 24, 36, 48, 72, 96, 144, 168, 336 and 504 h after dosing on day 78. | 22.5 mg | 110 ± 11.9 (Terminal Half Life) | Human serum protease | Double-antibody sandwich assay | Human serum | In Vivo | None | None | N.A. | |||
| 38807146 | 2024 | TG103 | 62 | Free | Fc region of IgG joined through (CH2-CH3) IgD | Linear | L | GLP-1 dimerization | GLP-1 analogs | Antiobesity | Blood sampling time points: (1) Within 2 h before dosing on day 1, day 8, day 15 and day 22, (2)6, 12, 24, 36, 48, 72, 96, 144 and 168 h (before dosing on day 29) after dosing on day 22,(3)Within 2 h before dosing on day 64, day 71 and day 78 (4) 6, 12, 24, 36, 48, 72, 96, 144, 168, 336 and 504 h after dosing on day 78. | 30.0 mg | 116 ± 9.34 (Terminal Half Life) | Human serum protease | Double-antibody sandwich assay | Human serum | In Vivo | None | None | N.A. | |||
| 38785334 | 2024 | Rusfertide (PTG-300) | 18 | IsoV = Isovaeryl at position 1 | Amidation | Cyclic(C7-C17 Disulfide Linkage) | L | Lys8 conjugation with palmitoyl-Glu(2)-OH | Synthetic | Provides therapy for PV and Hemochromatosis | N.A. | 10 mg | 26.1 ± 7.0 | Human plasma protease | HPLC-MS | Human plasma | In Vivo | None | None | N.A. | |||
| 38785334 | 2024 | Rusfertide (PTG-300) | 18 | IsoV = Isovaeryl at position 1 | Amidation | Cyclic(C7-C17 Disulfide Linkage) | L | Lys8 conjugation with palmitoyl-Glu(2)-OH | Synthetic | Provides therapy for PV and Hemochromatosis | N.A. | 20 mg | 35.4 ± 9.6 | Human plasma protease | HPLC-MS | Human plasma | In Vivo | None | None | N.A. | |||
| 38785334 | 2024 | Rusfertide (PTG-300) | 18 | IsoV = Isovaeryl at position 1 | Amidation | Cyclic(C7-C17 Disulfide Linkage) | L | Lys8 conjugation with palmitoyl-Glu(2)-OH | Synthetic | Provides therapy for PV and Hemochromatosis | N.A. | 40 mg | 45.0 ± 13 | Human plasma protease | HPLC-MS | Human plasma | In Vivo | None | None | N.A. | |||
| 38785334 | 2024 | Rusfertide (PTG-300) | 18 | IsoV = Isovaeryl at position 1 | Amidation | Cyclic(C7-C17 Disulfide Linkage) | L | Lys8 conjugation with palmitoyl-Glu(2)-OH | Synthetic | Provides therapy for PV and Hemochromatosis | N.A. | 80 mg | 52.5 ± 17 | Human plasma protease | HPLC-MS | Human plasma | In Vivo | None | None | N.A. | |||
| 38785334 | 2024 | Rusfertide (PTG-300) | 18 | IsoV = Isovaeryl at position 1 | Amidation | Cyclic(C7-C17 Disulfide Linkage) | L | Lys8 conjugation with palmitoyl-Glu(2)-OH | Synthetic | Provides Therapy For Pv And Hemochromatosis | N.A. | 40 mg | 49.6 ± 18 | Human Plasma Protease | high-performance liquidchromatography–tandem mass spectrometry method | Human plasma after 2 once weekly repeated dose | In Vivo | None | None | N.A. | |||
| 38785334 | 2024 | Rusfertide (PTG-300) | 18 | IsoV = Isovaeryl at position 1 | Amidation | Cyclic(C7-C17 Disulfide Linkage) | L | Lys8 conjugation with palmitoyl-Glu(2)-OH | Synthetic | Provides Therapy For Pv And Hemochromatosis | N.A. | 40 mg | 36.1 ± 21 | Human Plasma Protease | high-performance liquidchromatography–tandem mass spectrometry method | Human plasma after 2 once weekly repeated dose | In Vivo | None | None | N.A. | |||
| 38721043 | 2024 | EXT607 (R=OH) | 35 | Free | Cys modified PTH-1 linked with VitD3 through (PEG)36 | Linear | L | R= OH for Cys35 | PTH-1 derivative | Treatment of Hypoparathyroidism | Blood samples were collected at 0 (pre-dose), 0.083 (IV only), 0.25, 0.5, 1, 2, 4, 6, 12, 24, 36, 48, 60, and 72 h post-dose | 0.02 mg/kg | 32.3 | Cynomolgus monkeys plasma protease | ELISA | Cynomolgus monkeys plasma | In Vivo | None | None | EC50(nM) = 23.7 (Calcium responses of EXT607 in mammalian cells overexpressing human PTHR1) | |||
| 38721043 | 2024 | EXT607 (R=OH) | 35 | Free | Cys modified PTH-1 linked with VitD3 through (PEG)36 | Linear | L | R= OH for Cys35 | PTH-1 derivative | Treatment of Hypoparathyroidism | Blood samples were collected at 0 (pre-dose), 0.083 (IV only), 0.25, 0.5, 1, 2, 4, 6, 12, 24, 36, 48, 60, and 72 h post-dose | 0.02 mg/kg | 24.3 | Cynomolgus monkeys plasma protease | ELISA | Cynomolgus monkeys plasma | In Vivo | None | None | EC50(nM) = 23.7 (Calcium responses of EXT607 in mammalian cells overexpressing human PTHR1) | |||
| 38721043 | 2024 | EXT607 (R=OH) | 35 | Free | Cys modified PTH-1 linked with VitD3 through (PEG)36 | Linear | L | R= OH for Cys35 | PTH-1 derivative | Treatment of Hypoparathyroidism | Blood samples were collected at 0 (pre-dose), 0.083 (IV only), 0.25, 0.5, 1, 2, 4, 6, 12, 24, 36, 48, 60, and 72 h post-dose | 0.07 mg/kg | 27.7 | Cynomolgus monkeys plasma protease | ELISA | Cynomolgus monkeys plasma | In Vivo | None | None | EC50(nM) = 23.7 (Calcium responses of EXT607 in mammalian cells overexpressing human PTHR1) | |||
| 38486997 | 2024 | 1907-B | 40 | Free | Replacing the amide bond with a C-terminal acid | Cyclic (Lactam Bridge K17 & D21) | Mix | At position 10 of the peptide sequence, modifications involving octadecanedioic acid (C18) and a glycine/serine-based linker "GGSGSG" were introduced, Aib modification,D-serine | GLP-1 analogs | Antidiabetes | N.A. | 25.0 μg/kg | 84 | Cynomolgus monkeys plasma protease | HPLC-MS/MS | Cynomolgus monkeys plasma | In Vivo | None | None | GLP-1R EC50 (nmol/L) = 0.088 (for 1907-B) | |||
| 38399408 | 2024 | BI-X | N.A. | N.A. | N.A. | N.A. | N.A. | N.A. | Synthetic | Treatment Of Human Ocular Disease | serial blood samples were taken in EDTA anticoagulant pre-dose and at 1 h, 2 h, 4 h, 24 h, 48 h, 72 h, 96 h, and 168 h and 2, 4, 6, 8, and 10 weeks after dosing or until the last in-life timepoint of the animals. | 0.25 mg/eye | 3 | Cynomolgus Monkeys Plasma Protease | Immunocapture-LC-MS/MS | Cynomolgus monkeys plasma | In Vivo | None | None | Affinity binding site to human albumin (KD = 1.4 nM) | |||
| 38399408 | 2024 | BI-X | N.A. | N.A. | N.A. | N.A. | N.A. | N.A. | Synthetic | Treatment Of Human Ocular Disease | serial blood samples were taken in EDTA anticoagulant pre-dose and at 1 h, 2 h, 4 h, 24 h, 48 h, 72 h, 96 h, and 168 h and 2, 4, 6, 8, and 10 weeks after dosing or until the last in-life timepoint of the animals. | 0.25 mg/eye | 13.2 | Cynomolgus Monkeys Plasma Protease | Immunocapture-LC-MS/MS | Cynomolgus monkeys plasma | In Vivo | None | None | Affinity binding site to human albumin (KD = 1.4 nM) | |||
| 38399408 | 2024 | BI-X | N.A. | N.A. | N.A. | N.A. | N.A. | N.A. | Synthetic | Treatment Of Human Ocular Disease | serial blood samples were taken in EDTA anticoagulant pre-dose and at 1 h, 2 h, 4 h, 24 h, 48 h, 72 h, 96 h, and 168 h and 2, 4, 6, 8, and 10 weeks after dosing or until the last in-life timepoint of the animals. | 0.25 mg/eye | 11.8 | Cynomolgus Monkeys Plasma Protease | Immunocapture-LC-MS/MS | Cynomolgus monkeys plasma | In Vivo | None | None | Affinity binding site to human albumin (KD = 1.4 nM) | |||
| 38356317 | 2024 | Tirzepatide | 39 | Free | Amidation | Linear | L | C20 fatty diacid moiety conjugated with Lys20, Aib modification at position 2,13 | GLP-1 analogs | Antidiabetes | PK samples were collected after single and multiple doses, up to 109 weeks of continuous tirzepatide treatment | 2–500 ng/mL. | 5.4 | Human plasma protease | LC-MS | Human plasma | In Vivo | None | None | N.A. | |||
| 38340726 | 2024 | A1L35HR2m-Chol | 114 | Conjugation of angiotensin-converting enzyme 2 (ACE2)-derived peptide A1 to the N terminus of the viral HR2-derived peptide HR2m through a long flexible linker, | Chol conjugation at C terminal | Linear | L | None | fusion protein of A1 and HR2m | Antiviral (Inhibits Coronaviruses) | Sera were collected from these mice before (0 h) and 2, 4, 8, 12, 24, 48, 72, 120, 168, 240 and 336 h after injection | 5 mg/kg | 81.83 | Balb/c mice serum protease | N.A. | BALB/c mice serum | In Vivo | None | None | A1L35HR2m was highly potent in inhibiting SARS-CoV-2 infection with an IC50 value of 27 nM | |||
| 38340726 | 2024 | A1L35HR2m-Chol | 114 | Conjugation of angiotensin-converting enzyme 2 (ACE2)-derived peptide A1 to the N terminus of the viral HR2-derived peptide HR2m through a long flexible linker, | Chol conjugation at C terminal | Linear | L | None | fusion protein of A1 and HR2m | Antiviral (Inhibits Coronaviruses) | N.A. | 5 mg/kg | 89.8 | Balb/c mice serum protease | N.A. | Balb/c mice lung tissue homogenate | In Vivo | None | None | A1L35HR2m was highly potent in inhibiting SARS-CoV-2 infection with an IC50 value of 27 nM | |||
| 38340726 | 2024 | A1L35HR2m-Chol | 114 | Conjugation of angiotensin-converting enzyme 2 (ACE2)-derived peptide A1 to the N terminus of the viral HR2-derived peptide HR2m through a long flexible linker, | Chol conjugation at C terminal | Linear | L | None | fusion protein of A1 and HR2m | Antiviral (Inhibits Coronaviruses) | N.A. | 5 mg/kg | 49 | Balb/c mice serum protease | N.A. | Balb/c mice nose tissue homogenate | In Vivo | None | None | A1L35HR2m was highly potent in inhibiting SARS-CoV-2 infection with an IC50 value of 27 nM | |||
| 38006944 | 2024 | Fatty Acid Modified TMP | 108 | Free | Free | Linear | L | C41H70O15N4 fatty acid modification | TMP analogue | Treatment of Thrombocytopenia | N.A. | 100 μg/kg | 128.5 | Beagle dogs plasma protease | ELISA | Beagle dogs plasma | In Vivo | None | None | The modified TMPs, particularly the C41H70O15N4 group, showed enhanced and prolonged activity, reaching peak platelet counts of 5047 × 10⁹/L at 216 hours (enhanced platelet counts) | |||
| N.A. | 2024 | Compound 1 | 43 | Free | Amidation | Linear | Mix | Aib2, aMeF(2F)6, 4PallO, aMeL13, Ornl6, K17, Aib20, D-Glu24 aMeY25, and Ser39 substituitions, Lys17 linked with chemical group ((2-[2-(2-Amino-ethoxy)-ethoxy]-acetyl)2-(y-Glu)-CO-(CH2)16-CO2H) | Incretin Analog | Antidiabetes | Blood sample collected over 36 Hours | 4.06 nmol/kg | 68 | Dogs plasma protease | LC-MS | Dogs plasma | In Vivo | None | US 2023/0072968 W | N.A. | |||
| N.A. | 2024 | Compound 1 | 43 | Free | Amidation | Linear | Mix | Aib2, aMeF(2F)6, 4PallO, aMeL13, Ornl6, K17, Aib20, D-Glu24 aMeY25, and Ser39 substituitions, Lys17 linked with chemical group ((2-[2-(2-Amino-ethoxy)-ethoxy]-acetyl)2-(y-Glu)-CO-(CH2)16-CO2H) | Incretin Analog | Antidiabetes | Blood sample collected over 168 Hours | 386.4 nmol/kg | 64 | Dogs plasma protease | LC-MS | Dogs plasma | In Vivo | None | US 2023/0072968 W | N.A. | |||
| N.A. | 2024 | Compound 1 | 43 | Free | Amidation | Linear | Mix | Aib2, aMeF(2F)6, 4PallO, aMeL13, Ornl6, K17, Aib20, D-Glu24 aMeY25, and Ser39 substituitions, Lys17 linked with chemical group ((2-[2-(2-Amino-ethoxy)-ethoxy]-acetyl)2-(y-Glu)-CO-(CH2)16-CO2H) | Incretin Analog | Antidiabetes | Blood sample collected over 168 Hours | 350.4 nmol/kg | 77 | Dogs plasma protease | LC-MS | Dogs plasma | In Vivo | None | US 2023/0072968 W | N.A. | |||
| N.A. | 2024 | Compound 1 | 43 | Free | Amidation | Linear | Mix | Aib2, aMeF(2F)6, 4PallO, aMeL13, Ornl6, K17, Aib20, D-Glu24 aMeY25, and Ser39 substituitions, Lys17 linked with chemical group ((2-[2-(2-Amino-ethoxy)-ethoxy]-acetyl)2-(y-Glu)-CO-(CH2)16-CO2H) | Incretin Analog | Antidiabetes | Blood sample collected over 168 Hours | 352.5 nmol/kg | 76 | Dogs plasma protease | LC-MS | Dogs plasma | In Vivo | None | US 2023/0072968 W | N.A. | |||
| N.A. | 2024 | Compound 1 | 43 | Free | Amidation | Linear | Mix | Aib2, aMeF(2F)6, 4PallO, aMeL13, Ornl6, K17, Aib20, D-Glu24 aMeY25, and Ser39 substituitions, Lys17 linked with chemical group ((2-[2-(2-Amino-ethoxy)-ethoxy]-acetyl)2-(y-Glu)-CO-(CH2)16-CO2H) | Incretin Analog | Antidiabetes | Blood sample collected over 168 Hours | 375.7 nmol/kg | 46 | Dogs plasma protease | LC-MS | Dogs plasma after food is provided 1 min post dose | In Vivo | None | US 2023/0072968 W | N.A. | |||
| N.A. | 2024 | Compound 1 | 43 | Free | Amidation | Linear | Mix | Aib2, aMeF(2F)6, 4PallO, aMeL13, Ornl6, K17, Aib20, D-Glu24 aMeY25, and Ser39 substituitions, Lys17 linked with chemical group ((2-[2-(2-Amino-ethoxy)-ethoxy]-acetyl)2-(y-Glu)-CO-(CH2)16-CO2H) | Incretin Analog | Antidiabetes | Blood sample collected over 168 Hours | 377.1 nmol/kg | 55 | Dogs plasma protease | LC-MS | Dogs plasma after food is provided 30 min post dose | In Vivo | None | US 2023/0072968 W | N.A. | |||
| N.A. | 2024 | Compound 2 | 40 | Free | Amidation | Linear | Mix | Aib2, aMeF(2F)6, aMeL13, Ornl6, K17, Aib20, D-Glu24, and Ser39 substituitions, Lys17 linked with chemical group ((2-[2-(2-Amino-ethoxy)-ethoxy]-acetyl)2-(y-Glu)-CO-(CH2)16-CO2H) | Incretin Analog | Antidiabetes | Blood sample collected over 336 Hours | 4.06 nmol/kg | 105 | Dogs plasma protease | LC-MS | Dogs plasma after food is provided 30 min post dose | In Vivo | None | US 2023/0072968 W | N.A. | |||
| N.A. | 2024 | Compound 2 | 40 | Free | Amidation | Linear | Mix | Aib2, aMeF(2F)6, aMeL13, Ornl6, K17, Aib20, D-Glu24, and Ser39 substituitions, Lys17 linked with chemical group ((2-[2-(2-Amino-ethoxy)-ethoxy]-acetyl)2-(y-Glu)-CO-(CH2)16-CO2H) | Incretin Analog | Antidiabetes | Blood sample collected over 168 Hours | 389 nmol/kg | 96 | Dogs plasma protease | LC-MS | Dogs plasma after treatment with Sodium Caprate (C10, 280Mg) | In Vivo | None | US 2023/0072968 W | N.A. | |||
| N.A. | 2024 | Compound 3 | 40 | Free | Amidation | Linear | L | Aib2, Aibl3 and 1-Nal22 substituitions, Lys20 linked with chemical group ((2-[2-(2-Amino-ethoxy)-ethoxy]-acetyl)2-(y-Glu)-CO-(CH2)18-CO2H) | Incretin Analog | Antidiabetes | Blood sample collected over 336 Hours | 4.01 nmol/kg | 104 | Dogs plasma protease | LC-MS | Dogs plasma | In Vivo | None | US 2023/0072968 W | N.A. | |||
| N.A. | 2024 | Compound 3 | 40 | Free | Amidation | Linear | L | Aib2, Aibl3 and 1-Nal22 substituitions, Lys20 linked with chemical group ((2-[2-(2-Amino-ethoxy)-ethoxy]-acetyl)2-(y-Glu)-CO-(CH2)18-CO2H) | Incretin Analog | Antidiabetes | Blood sample collected over 336 Hours | 20 mg | 111 | Dogs plasma protease | LC-MS | Dogs plasma | In Vivo | None | US 2023/0072968 W | N.A. | |||
| N.A. | 2024 | Compound 3 | 40 | Free | Amidation | Linear | L | Aib2, Aibl3 and 1-Nal22 substituitions, Lys20 linked with chemical group ((2-[2-(2-Amino-ethoxy)-ethoxy]-acetyl)2-(y-Glu)-CO-(CH2)18-CO2H) | Incretin Analog | Antidiabetes | Blood sample collected over 336 Hours | 20 mg | 104 | Dogs plasma protease | LC-MS | Dogs plasma | In Vivo | None | US 2023/0072968 W | N.A. | |||
| N.A. | 2024 | TZP | 40 | Free | Amidation | Linear | L | Aib2, Aibl3 substituitions, Lys20 linked with chemical group ((2-[2-(2-Amino-ethoxy)-ethoxy]-acetyl)2-(y-Glu)1-CO-(CH2)18-CO2H) | Incretin Analog | Antidiabetes | Blood sample collected over 336 Hours | 4.15 nmol/kg | 70 | Dogs plasma protease | LC-MS | Dogs plasma | In Vivo | None | US 2023/0072968 W | N.A. | |||
| N.A. | 2024 | TZP | 40 | Free | Amidation | Linear | L | Aib2, Aibl3 substituitions, Lys20 linked with chemical group ((2-[2-(2-Amino-ethoxy)-ethoxy]-acetyl)2-(y-Glu)1-CO-(CH2)18-CO2H) | Incretin Analog | Antidiabetes | Blood sample collected over 336 Hours | 4.15 nmol/kg | 159 | Dogs plasma protease | LC-MS | Dogs plasma | In Vivo | None | US 2023/0072968 W | N.A. | |||
| N.A. | 2024 | TZP | 40 | Free | Amidation | Linear | L | Aib2, Aibl3 substituitions, Lys20 linked with chemical group ((2-[2-(2-Amino-ethoxy)-ethoxy]-acetyl)2-(y-Glu)1-CO-(CH2)18-CO2H) | Incretin Analog | Antidiabetes | Blood sample collected over 336 Hours | 20 mg | 97 | Dogs plasma protease | LC-MS | Dogs plasma | In Vivo | None | US 2023/0072968 W | N.A. | |||
| 38288338 | 2024 | Efpeglenatide | 39 | N terminal amine group of His replaced by imidazo-acetyl | Amidation | Linear | L | Conjugate in which LYS27 side chain linked to PEG-Fc | Exendin-4 analogs | Antidiabetes | Blood samples were taken for PK measures pre-dose and at 1, 2, 4, 8, and 12 h post-dose on day 1, and once on days 2, 4, 7, 10, 14, 21, 28, 35, 42, and 49 | 4 μg/kg | 144 (terminal elimination half life) | Human serum protease | Sandwich ELISA | Human serum | In Vivo | https://pubmed.ncbi.nlm.nih.gov/32175655/ | None | N.A. | |||
| 38288338 | 2024 | Efpeglenatide | 39 | N terminal amine group of His replaced by imidazo-acetyl | Amidation | Linear | L | Conjugate in which LYS27 side chain linked to PEG-Fc | Exendin-4 analogs | Antidiabetes | Blood samples were taken for PK measures pre-dose and at 1, 2, 4, 8, and 12 h post-dose on day 1, and once on days 2, 4, 7, 10, 14, 21, 28, 35, 42, and 49 | 8 μg/kg | 147 (terminal elimination half life) | Human serum protease | Sandwich ELISA | Human serum | In Vivo | https://pubmed.ncbi.nlm.nih.gov/32175655/ | None | N.A. | |||
| 38288338 | 2024 | Efpeglenatide | 39 | N terminal amine group of His replaced by imidazo-acetyl | Amidation | Linear | L | Conjugate in which LYS27 side chain linked to PEG-Fc | Exendin-4 analogs | Antidiabetes | Blood samples were taken for PK measures pre-dose and at 1, 2, 4, 8, and 12 h post-dose on day 1, and once on days 2, 4, 7, 10, 14, 21, 28, 35, 42, and 49 | 14 μg/kg | 135 (terminal elimination half life) | Human serum protease | Sandwich ELISA | Human serum | In Vivo | https://pubmed.ncbi.nlm.nih.gov/32175655/ | None | N.A. | |||
| 38288338 | 2024 | Efpeglenatide | 39 | N terminal amine group of His replaced by imidazo-acetyl | Amidation | Linear | L | Conjugate in which LYS27 side chain linked to PEG-Fc | Exendin-4 analogs | Antidiabetes | Blood samples were taken for PK measures pre-dose and at 1, 2, 4, 8, and 12 h post-dose on day 1, and once on days 2, 4, 7, 10, 14, 21, 28, 35, 42, and 49 | 20 μg/kg | 147 (terminal elimination half life) | Human serum protease | Sandwich ELISA | Human serum | In Vivo | https://pubmed.ncbi.nlm.nih.gov/32175655/ | None | N.A. | |||
| 38288338 | 2024 | Efpeglenatide | 39 | N terminal amine group of His replaced by imidazo-acetyl | Amidation | Linear | L | Conjugate in which LYS27 side chain linked to PEG-Fc | Exendin-4 analogs | Antidiabetes | Blood samples were taken for PK measures pre-dose and at 1, 2, 4, 8, and 12 h post-dose on day 1, and once on days 2, 4, 7, 10, 14, 21, 28, 35, 42, and 49 | 40 μg/kg | 141 (terminal elimination half life) | Human serum protease | Sandwich ELISA | Human serum | In Vivo | https://pubmed.ncbi.nlm.nih.gov/32175655/ | None | N.A. | |||
| 38288338 | 2024 | Efpeglenatide | 39 | N terminal amine group of His replaced by imidazo-acetyl | Amidation | Linear | L | Conjugate in which LYS27 side chain linked to PEG-Fc | Exendin-4 analogs | Antidiabetes | Blood samples were taken for PK measures pre-dose and at 1, 2, 4, 8, and 12 h post-dose on day 1, and once on days 2, 4, 7, 10, 14, 21, 28, 35, 42, and 49 | 60 μg/kg | 154 (terminal elimination half life) | Human serum protease | Sandwich ELISA | Human serum | In Vivo | https://pubmed.ncbi.nlm.nih.gov/32175655/ | None | N.A. | |||
| 38288338 | 2024 | Efpeglenatide | 39 | N terminal amine group of His replaced by imidazo-acetyl | Amidation | Linear | L | Conjugate in which LYS27 side chain linked to PEG-Fc | Exendin-4 analogs | Antidiabetes | Blood samples were taken for PK measures pre-dose and at 1, 2, 4, 8, and 12 h post-dose on day 1, and once on days 2, 4, 7, 10, 14, 21, 28, 35, 42, and 49 | 100 μg/kg | 180 (terminal elimination half life) | Human serum protease | Sandwich ELISA | Human serum | In Vivo | https://pubmed.ncbi.nlm.nih.gov/32175655/ | None | N.A. | |||
| 38288338 | 2024 | Efpeglenatide | 39 | N terminal amine group of His replaced by imidazo-acetyl | Amidation | Linear | L | Conjugate in which LYS27 side chain linked to PEG-Fc | Exendin-4 analogs | Antidiabetes | blood samples were taken for PK assessments pre-dose on the first dosing day (day 1) and 8, 24, 48, 72, 96, 120, and 144 h after the first dose. Trough samples were taken immediately before dosing on days 8, 22, 36, and 50. Samples were taken again after the last (eighth) dose at 8, 24, 48, 72, 96, 120, and 144 h after dosing and 7, 10, 14, 21, 28, and 35 days after dosing | 1 mg | 155.03 (terminal elimination half life) | Human serum protease | Sandwich ELISA | Human serum | In Vivo | https://pubmed.ncbi.nlm.nih.gov/32175655/ | None | N.A. | |||
| 38288338 | 2024 | Efpeglenatide | 39 | N terminal amine group of His replaced by imidazo-acetyl | Amidation | Linear | L | Conjugate in which LYS27 side chain linked to PEG-Fc | Exendin-4 analogs | Antidiabetes | blood samples were taken for PK assessments pre-dose on the first dosing day (day 1) and 8, 24, 48, 72, 96, 120, and 144 h after the first dose. Trough samples were taken immediately before dosing on days 8, 22, 36, and 50. Samples were taken again after the last (eighth) dose at 8, 24, 48, 72, 96, 120, and 144 h after dosing and 7, 10, 14, 21, 28, and 35 days after dosing | 2 mg | 151.53 ( terminal elimination half life) | Human serum protease | Sandwich ELISA | Human serum | In Vivo | https://pubmed.ncbi.nlm.nih.gov/32175655/ | None | N.A. | |||
| 38288338 | 2024 | Efpeglenatide | 39 | N terminal amine group of His replaced by imidazo-acetyl | Amidation | Linear | L | Conjugate in which LYS27 side chain linked to PEG-Fc | Exendin-4 analogs | Antidiabetes | blood samples were taken for PK assessments pre-dose on the first dosing day (day 1) and 8, 24, 48, 72, 96, 120, and 144 h after the first dose. Trough samples were taken immediately before dosing on days 8, 22, 36, and 50. Samples were taken again after the last (eighth) dose at 8, 24, 48, 72, 96, 120, and 144 h after dosing and 7, 10, 14, 21, 28, and 35 days after dosing | 4 mg | 155.85 (terminal elimination half life) | Human serum protease | Sandwich ELISA | Human serum | In Vivo | https://pubmed.ncbi.nlm.nih.gov/32175655/ | None | N.A. | |||
| 38288338 | 2024 | Efpeglenatide | 39 | N terminal amine group of His replaced by imidazo-acetyl | Amidation | Linear | L | Conjugate in which LYS27 side chain linked to PEG-Fc | Exendin-4 analogs | Antidiabetes | blood samples were taken for PK assessments pre-dose on the first dosing day (day 1) and 8, 24, 48, 72, 96, 120, and 144 h after the first dose. Samples were also taken 7, 10, 14, and 21 days after dosing. Trough samples were taken immediately before dosing on days 29 and 57. Finally, after the last (third) dose, samples were taken 8, 24, 48, 72, 96, 120, and 144 h after dosing and 7, 10, 14, 21, 28, and 35 days after dosing | 8 mg | 159.95 (terminal elimination half life) | Human serum protease | Sandwich ELISA | Human serum | In Vivo | https://pubmed.ncbi.nlm.nih.gov/32175655/ | None | N.A. | |||
| 38288338 | 2024 | Efpeglenatide | 39 | N terminal amine group of His replaced by imidazo-acetyl | Amidation | Linear | L | Conjugate in which LYS27 side chain linked to PEG-Fc | Exendin-4 analogs | Antidiabetes | blood samples were taken for PK assessments pre-dose on the first dosing day (day 1) and 8, 24, 48, 72, 96, 120, and 144 h after the first dose. Samples were also taken 7, 10, 14, and 21 days after dosing. Trough samples were taken immediately before dosing on days 29 and 57. Finally, after the last (third) dose, samples were taken 8, 24, 48, 72, 96, 120, and 144 h after dosing and 7, 10, 14, 21, 28, and 35 days after dosing | 12 mg | 170.62 (terminal elimination half life) | Human serum protease | Sandwich ELISA | Human serum | In Vivo | https://pubmed.ncbi.nlm.nih.gov/32175655/ | None | N.A. | |||
| 38288338 | 2024 | Efpeglenatide | 39 | N terminal amine group of His replaced by imidazo-acetyl | Amidation | Linear | L | Conjugate in which LYS27 side chain linked to PEG-Fc | Exendin-4 analogs | Antidiabetes | blood samples were taken for PK assessments pre-dose on the first dosing day (day 1) and 8, 24, 48, 72, 96, 120, and 144 h after the first dose. Samples were also taken 7, 10, 14, and 21 days after dosing. Trough samples were taken immediately before dosing on days 29 and 57. Finally, after the last (third) dose, samples were taken 8, 24, 48, 72, 96, 120, and 144 h after dosing and 7, 10, 14, 21, 28, and 35 days after dosing | 16 mg | 161.76 (terminal elimination half life) | Human serum protease | Sandwich ELISA | Human serum | In Vivo | https://pubmed.ncbi.nlm.nih.gov/32175655/ | None | N.A. | |||
| 38952487 | 2024 | [3H]-semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18(3H) | GLP-1 analogs | GLP-1 receptor agonist | Blood sample were collected at predose, 8, 16, 24,32,40,48,56,64,72,96,120,144,168,240,336,504,672 and 840 hours post dose | 1 mg/ml | 168.3 | Human plasma protease | LC-MS/MS | Human plasma | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Intact [3H]-semaglutide-related material | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18(3H), other metabolite may be attached | GLP-1 analogs | GLP-1 receptor agonist | Blood sample were collected at predose, 8, 16, 24,32,40,48,56,64,72,96,120,144,168,240,336,504,672 and 840 hours post dose | 1 mg/ml | 201.2 | Human plasma protease | LC-MS/MS | Human plasma | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Dry [3H]-semaglutide-related material | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18(3H), other metabolite may be attached | GLP-1 analogs | GLP-1 receptor agonist | Blood sample were collected at predose, 8, 16, 24,32,40,48,56,64,72,96,120,144,168,240,336,504,672 and 840 hours post dose | 1 mg/ml | 180.5 | Human plasma protease | LC-MS/MS | Human plasma | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | Blood samples for PK assessment of semaglutide were taken at the following time points after the first dose: 0, 6, 12, 18, 24, 30, 36, 42, 48, 60, 72, 84, 96, 120, 144 and 168 h and at the following time points after the last dose: 0, 6, 12, 18, 24, 30, 36, 42, 48, 60, 72, 84, 96, 120, 144, 168, 336, 504, 672 and 840 h. Additional PK samples were taken before dosing in weeks 4, 8 and 11 | 0.5 mg | 156 | Human blood sample protease | LC-MS/MS | Human blood sample with once weekly dosage (at steady state) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | Blood samples for PK assessment of semaglutide were taken at the following time points after the first dose: 0, 6, 12, 18, 24, 30, 36, 42, 48, 60, 72, 84, 96, 120, 144 and 168 h and at the following time points after the last dose: 0, 6, 12, 18, 24, 30, 36, 42, 48, 60, 72, 84, 96, 120, 144, 168, 336, 504, 672 and 840 h. Additional PK samples were taken before dosing in weeks 4, 8 and 11 | 1 mg | 159 | Human blood sample protease | LC-MS/MS | Human blood sample with once weekly dosage (at steady state) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | blood samples were taken 15 min prior to administration of semaglutide and 2, 8, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 38, 42, 48, 54, 60, 66, 72, 96, 144, 192, 240, 360, and 480 h after administration of semaglutide | 0.5 mg | 183 (elimination half life) | Human serum protease | LC-MS/MS | Human serum (Normal Renal Function Group) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | blood samples were taken 15 min prior to administration of semaglutide and 2, 8, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 38, 42, 48, 54, 60, 66, 72, 96, 144, 192, 240, 360, and 480 h after administration of semaglutide | 0.5 mg | 169 (elimination half life) | Human serum protease | LC-MS/MS | Human serum (Mild Renal Function Group) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | blood samples were taken 15 min prior to administration of semaglutide and 2, 8, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 38, 42, 48, 54, 60, 66, 72, 96, 144, 192, 240, 360, and 480 h after administration of semaglutide | 0.5 mg | 201 (elimination half life) | Human serum protease | LC-MS/MS | Human serum (Moderate Renal Function Group) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | blood samples were taken 15 min prior to administration of semaglutide and 2, 8, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 38, 42, 48, 54, 60, 66, 72, 96, 144, 192, 240, 360, and 480 h after administration of semaglutide | 0.5 mg | 221 (elimination half life) | Human serum protease | LC-MS/MS | Human serum (Severe Renal Function Group) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | For ESRD subjects on hemodialysis, hourly blood samples were drawn during each of the first two hemodialysis sessions post-administration (each hemodialysis session lasted for ~2–4 h). | 0.5 mg | 243 (elimination half life) | Human serum protease | LC-MS/MS | Human serum dosage 1–24 H after hemodialysis, With No Hemodialysis For 48 H Post-Dose (End Stage Renal Disease Renal Function Group) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | Blood samples were taken to determine the plasma concentration profiles of semaglutide 15 minutes prior to dosing, at time zero, and at 6, 12, 18, 24, 30, 36, 42, 48, 54, 60, 72, 96, 120, 144, 168, 336, 504, 672 and 840 hours (up to 35 days) after administration of semaglutide | 0.5 mg | 150 (Terminal elimination half life) | Human plasma protease | LC-MS/MS | Human plasma (Normal Hepatic Function Group) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | Blood samples were taken to determine the plasma concentration profiles of semaglutide 15 minutes prior to dosing, at time zero, and at 6, 12, 18, 24, 30, 36, 42, 48, 54, 60, 72, 96, 120, 144, 168, 336, 504, 672 and 840 hours (up to 35 days) after administration of semaglutide | 0.5 mg | 155 (Terminal elimination half life) | Human plasma protease | LC-MS/MS | Human plasma (Mild Hepatic Function Group) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | Blood samples were taken to determine the plasma concentration profiles of semaglutide 15 minutes prior to dosing, at time zero, and at 6, 12, 18, 24, 30, 36, 42, 48, 54, 60, 72, 96, 120, 144, 168, 336, 504, 672 and 840 hours (up to 35 days) after administration of semaglutide | 0.5 mg | 151 (Terminal elimination half life) | Human plasma protease | LC-MS/MS | Human plasma (Moderate Hepatic Function Group) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | Blood samples were taken to determine the plasma concentration profiles of semaglutide 15 minutes prior to dosing, at time zero, and at 6, 12, 18, 24, 30, 36, 42, 48, 54, 60, 72, 96, 120, 144, 168, 336, 504, 672 and 840 hours (up to 35 days) after administration of semaglutide | 0.5 mg | 163 (Terminal elimination half life) | Human plasma protease | LC-MS/MS | Human plasma (Severe Hepatic Function Group) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | N.A. | 20 mg | 153 | Human plasma protease | Luminescence oxygen channelling immunoassay (LOCI) | Human plasma dosed at steady state (Healthy) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | N.A. | 40 mg | 161 | Human plasma protease | Luminescence oxygen channelling immunoassay (LOCI) | Human plasma dosed at steady state (Healthy) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | N.A. | 40 mg | 158 | Human plasma protease | Luminescence oxygen channelling immunoassay (LOCI) | Human plasma dosed at steady state (Type 2 Diabetic) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | 10 days | 10 mg | 160 | Human plasma protease | LC-MS/MS | Human plasma dosed with 10 mg Once Daily Semaglutide (Subjects In The Fasting Arm Were Fasting Overnight For At Least 10 H Before Each Dosing) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | 10 days | 10 mg | 152 | Human plasma protease | LC-MS/MS | Human plasma dosed with 10 Mg Once Daily Semaglutide (Subjects In The Reference Arm Were Fasting Overnight For At Least 6 H Before Each Dosing) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | Blood samples for semaglutide PK assessment were drawn onday 1 (pre- and post-dose), then pre-dose on days 6 to 10 | 7 mg | 141 | Human plasma protease | N.A. | Human plasma (Type 2 Diabetic Patient With Upper Gastrointestinal Disease) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | Blood samples for semaglutide PK assessment were drawn onday 1 (pre- and post-dose), then pre-dose on days 6 to 10 | 7 mg | 142 | Human plasma protease | N.A. | Human plasma (Type 2 Diabetic Patient Without Upper Gastrointestinal Disease) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | Blood samples were drawn into K3EDTA tubes pre-dose on day 1, and at set time points on days 9 and 10 | 10 mg | 150 | Human plasma protease | LC-MS/MS | Human plasma dosed with 10 mg Semaglutide Once Daily For 5 Days | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38952487 | 2024 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | Blood samples were drawn into K3EDTA tubes pre-dose on day 1, and at set time points on days 9 and 10 | 10 mg | 156 | Human plasma protease | LC-MS/MS | Human plasma dosed with 10 mg Semaglutide Once Daily For 5 Days And With Omeprazole 40 Mg | In Vivo | https://pubmed.ncbi.nlm.nih.gov/28323117/, https://pubmed.ncbi.nlm.nih.gov/29205786/, https://pubmed.ncbi.nlm.nih.gov/33159658/ | None | N.A. | |||
| 38116563 | 2023 | Ex-DARP-FGF21 | 327 | Exendin-4 peptide (Ex) fused to the N-terminus of the DARPin (DARP) protein via (GGGGS)3, His-tag and TEV protease site introduced at position 1 | FGF21 fused to the C-terminus of the DARPin (DARP) protein via (GGGGS)3 linker | Linear | L | L98R and P171A amino acid substitutions in FBGF21 | Exendin-4, DARPin, FGF21 fusion protein | Antidiabetes, Antiobesity | Approximately 40 µL of blood was collected from the orbital venous plexus at different time points (1, 3, 8, 12, 24, 36, 48, and 72 h) | 10 nmol/kg | 27.6 ± 3.2 | C57BL/6 mice plasma protease | ELISA | C57BL/6 mice plasma | In Vivo | None | None | Ex-DARP-FGF21 and Ex-DARP were efficaciously bound to HSA with half-maximal binding concentrations of 4.5 nM and 1.9 nM, respectively | |||
| 37874823 | 2023 | MDK1472 | 42 | Acetylation | Free | Cyclic (Disulphide Bond Bw C7-C16, C32-C41) | L | IL-7Ra binding domain linked with yc binding domain with the help of linker GGS linker | Synthetic | IL-7R agonist peptide | 37 °C | 10 mM | 60 | Human Plasma Protease | LC-MS/MS | Human plasma | In Vitro | None | None | IC50(nM) = 340 (IC50 values in a competition ELISA for compound binding to human IL-7Rα) | |||
| 37874823 | 2023 | MDK1472 | 42 | Acetylation | Free | Cyclic (Disulphide Bond Bw C7-C16, C32-C41) | L | IL-7Ra binding domain linked with yc binding domain with the help of linker GGS linker | Synthetic | IL-7R agonist peptide | 37 °C | 10 mM | 104 | Cynomolgus monkeys plasma protease | LC-MS/MS | Cynomolgus monkeys plasma | In Vitro | None | None | IC50(nM) = 190 (IC50 values in a competition ELISA for compound binding to Cyno IL-7Rα) | |||
| 37874823 | 2023 | MDK-703 | 110 | Fused with IgG2 Fc chain via (Gly-Ser)10 linker, Fc-fragments consisting of the CH2 and CH3 domains of the heavy chain and hinge regions of human IgG2 Fc modified as follows: The first and second cysteines of the hinge region were replaced with serine to prevent detrimental disulfide bridge formation; the last amino acid (lysine) of the Fc region was replaced with an alanine | Free | Linear | L | None | Synthetic | IL-7R agonist peptide | Blood samples were collected at pre-Dose (day 1), 0.5, 1 h, 2 h, 4 h, 8 h, 24 h, 48 h, 72 h, 96 h, 120 h, 144 h, 168 h, 192 h, and 216 h post-dose | 1 mg/kg | 46 (Terminal Half Life) | Cynomolgus monkeys serum protease | Sandwich ELISA | Cynomolgus monkeys serum | In Vivo | None | None | IC50(nM) = 190 (IC50 values in a competition ELISA for compound binding to Cyno IL-7Rα) | |||
| 37759683 | 2023 | IBP-EK1 | 32 | Conjugation with human immunoglobulin G Fc-binding peptide (IBP) at n terminus | Free | Linear | L | None | Fusion protein | Antiviral | Serial blood samples were collected from monkeys that received IBP-EK1 or EK1 before injection and at 2, 4, 6, 24, 72, and 144 h post injection | 10 mg/kg | 37.67 | Rhesus monkeys serum protease | HPLC-MS/MS | Rhesus monkeys serum | In Vivo | None | None | IC50 = 788 nM for IBP-EK1 ( against Pseudotyped SARS-CoV-2 Variants on Caco-2 Cells) | |||
| 37759683 | 2023 | IBP-EK1 | 32 | Conjugation with human immunoglobulin G Fc-binding peptide (IBP) at n terminus | Free | Linear | L | None | Fusion protein | Antiviral | Serial blood samples were collected from monkeys that received IBP-EK1 or EK1 before injection and at 2, 4, 6, 24, 72, and 144 h post injection | 10 mg/kg | 39.72 | Rhesus monkeys serum protease | HPLC-MS/MS | Rhesus monkeys serum | In Vivo | None | None | IC50 = 788 nM for IBP-EK1 ( against Pseudotyped SARS-CoV-2 Variants on Caco-2 Cells) | |||
| 36780899 | 2023 | LY3540378 | 64 | Free | Relaxin-A chain linked with albVHH domain at C terminus, A and B chain linked by linker | Linear | L | None | relaxin-2 analog | Treatment of Chronic Heart Failure | N.A. | 200 nmol/kg | 36.4 (Terminal Half Life) | Rats plasma protease | LC-MS | Rats plasma | In Vivo | None | None | EC 50 (nM) = 109 ± 24 of LY3540378 in Rat RXFP2 | |||
| 36780899 | 2023 | LY3540378 | 64 | Free | Relaxin-A chain linked with albVHH domain at C terminus, A and B chain linked by linker | Linear | L | None | relaxin-2 analog | Treatment of Chronic Heart Failure | N.A. | 100 nmol/kg | 124 (Terminal Half Life) | Cynomolgus monkeys plasma protease | LC-MS | Cynomolgus monkeys plasma | In Vivo | None | None | EC 50 (nM) = 19.3 ± 4.0 of LY3540378 in Cynomolgus monkey RXFP2 | |||
| 36780899 | 2023 | LY3540378 | 64 | Free | Relaxin-A chain linked with albVHH domain at C terminus, A and B chain linked by linker | Linear | L | None | relaxin-2 analog | Treatment of Chronic Heart Failure | N.A. | 100 nmol/kg | 45.7 (Terminal Half Life) | Cynomolgus monkeys plasma protease | LC-MS | Cynomolgus monkeys plasma | In Vivo | None | None | EC 50 (nM) = 19.3 ± 4.0 of LY3540378 in Cynomolgus monkey RXFP2 | |||
| 36780899 | 2023 | LY3540378 | 64 | Free | Relaxin-A chain linked with albVHH domain at C terminus, A and B chain linked by linker | Linear | L | None | relaxin-2 analog | Treatment of Chronic Heart Failure | N.A. | 30 nmol/kg | 39.7 ± 1.8 (Terminal Half Life) | SD rats plasma protease | LC-MS | SD rats plasma | In Vivo | None | None | EC 50 (nM) = 109 ± 24 of LY3540378 in Rat RXFP2 | |||
| 36630826 | 2023 | Ex-PEGMw(46.3KDa) | 39 | Free | PEGylation (Mw(46.3KDa)) and linked via DBCO | Linear | L | Fluorescently labeled | Exendin-4 analogs | Antidiabetes | Blood collection at 5-min, 1-, 2-, 4-, 8-, 24-, 48-, 72-, 96-, 120-, 144- and 168-h | 1000 nmol kg−1 | 34.91 ± 4.5(T1/2 Elimination) | Naïve mice plasma protease | Fluorescence assay | Naïve mice plasma | In Vivo | None | None | EC50 = 2.7 ± 0.5 nM | |||
| 36630826 | 2023 | Ex-POEGMAopt(54.7KDa) | 39 | Free | POEGMA (poly[oligo(ethylene glycol) methyl ether methacrylate]) conjugation (MW opt = 54.7KDa) | Linear | L | Fluorescently labeled | Exendin-4 analogs | Antidiabetes | Blood collection at 5-min, 1-, 2-, 4-, 8-, 24-, 48-, 72-, 96-, 120-, 144- and 168-h | 1000 nmol kg−1 | 97.3 ± 3.2(T1/2 Elimination) | Naïve mice plasma protease | Fluorescence assay | Naïve mice plasma | In Vivo | None | None | EC50 = 2.8 ± 0.7 nM | |||
| 36630826 | 2023 | Ex-POEGMAopt(54.7KDa) | 39 | Free | POEGMA (poly[oligo(ethylene glycol) methyl ether methacrylate]) conjugation (MW opt = 54.7KDa) | Linear | L | Fluorescently labeled | Exendin-4 analogs | Antidiabetes | Blood collection at 5-min, 1-, 2-, 4-, 8-, 24-, 48-, 72-, 96-, 120-, 144- and 168-h | 1000 nmol kg−1 | 105.7 ± 6 (T1/2 Elimination) | Immunized mice plasma protease | Fluorescence assay | Immunized mice plasma | In Vivo | None | None | EC50 = 2.8 ± 0.7 nM | |||
| 36410792 | 2023 | HM15912 | 34 | [(1H-imidazol-4-yl)-acetyl 1] | Conjugation of GT15912 and hIgG4 Fc was carried out through the formation of amine bonds between the bi functional PEG and Lys34 in GT15912 or the N-terminal amino acid in hIgG4 Fc | Linear | L | None | GLP-2 analogue | Small Bowel Hypertrophic Effect | Blood (0.3 ml) was then collected from the jugularvein at 0.25, 0.5, 1, 1.5, 2, 3, 4, 6, and 8 hours for teduglutide and 1, 4, 8, 24, 48, 72, 96, 230, 244, 268, 192, 216, 240, 264, 288, 312, and 336 hours for HM15912 | 13 nmol/kg | 42.3 ± 3.4 | SD rats serum protease | GLP-2 ELISA | SD rats serum | In Vivo | None | None | EC50 = 0.327 ± 0.096 nM for HM15912 peptide (In vitro potency of GLP-2 analogs on human GLP-2 receptor in cell-based functional assays of dose-response cAMP) | |||
| 36630826 | 2023 | Ex-PEGMw | 39 | Fluorescently labelled | Exendin-DBCO was conjugated to azide-functional PEG(46.3 KDa) | Linear | L | None | Exendin-4 analogs | Antidiabetes | Ten μl of blood was collected from a tiny incision on the tail vein into tubes containing 90 μl of 1,000 U ml-1 heparin (Sigma) at 5-min, 1-, 2-, 4-, 8-, 24-, 48-, 72-, 96-, 120-, 144- and 168-h. | 1000 nmol/kg | 34.91 ± 4.5 (T1/2 Elimination) | Naïve mice plasma protease | fluorescence assay | Naïve mice plasma | In Vivo | None | None | EC50 (nM) = 2.7 ± 0.5 | |||
| 36630826 | 2023 | Ex-POEGMAopt | 39 | Fluorescently labelled | Exendin-DBCO was conjugated to azide-functional POEGMA(54.7KDa) | Linear | L | None | Exendin-4 analogs | Antidiabetes | Ten μl of blood was collected from a tiny incision on the tail vein into tubes containing 90 μl of 1,000 U ml-1 heparin (Sigma) at 5-min, 1-, 2-, 4-, 8-, 24-, 48-, 72-, 96-, 120-, 144- and 168-h. | 1000 nmol/kg | 97.3 ± 3.2 (T1/2 Elimination) | Naïve mice plasma protease | fluorescence assay | Naïve mice plasma | In Vivo | None | None | EC50 (nM) = 2.8 ± 0.7 | |||
| 36630826 | 2023 | Ex-POEGMAopt | 39 | Fluorescently labelled | Exendin-DBCO was conjugated to azide-functional POEGMA(54.7KDa) | Linear | L | None | Exendin-4 analogs | Antidiabetes | Ten μl of blood was collected from a tiny incision on the tail vein into tubes containing 90 μl of 1,000 U ml-1 heparin (Sigma) at 5-min, 1-, 2-, 4-, 8-, 24-, 48-, 72-, 96-, 120-, 144- and 168-h. | 1000 nmol/kg | 105.7 ± 6 (T1/2 Elimination) | Immunized mice plasma protease | fluorescence assay | Immunized mice plasma | In Vivo | None | None | EC50 (nM) = 2.8 ± 0.7 | |||
| N.A. | 2023 | SEQ ID NO 19 | 39 | Free | Amidation | Linear | L | Aib = α-aminoisobutyric acid | Exendin-4 analogs | Antidiabetes | Blood samples were collected at 0 H and after 0.083, 0.25, 0.5, 1 , 2, 4, 8, 24, 32, 48, 56, 72, 80, and 96 H post I.V. application | 0.05 mg/kg | 64.1 | Minipigs plasma protease | LC-MS | Minipigs plasma | In Vivo | None | EP 2022074607 W | IC50 hGIPR (nM) = 2 | |||
| N.A. | 2023 | SEQ ID NO 23 | 29 | Free | Free | Linear | L | X = Octanoyl-Dpr at position 3 | Human Ghrelin Analog | Ghrelin Receptor Agonist | Solutions were incubated at 37 C for 60, 120 and 180 Minutes | 1 mg/ml | >58 | Plasma protease | LC-MS | Diluted plasma | In Vitro | None | EP 2023054305 W | EC50(nM) = 103 | |||
| N.A. | 2023 | SEQ ID NO 24 | 29 | Free | Free | Linear | L | X = Octanoyl-Dpr at position 3 | Human Ghrelin Analog | Ghrelin Receptor Agonist | Solutions were incubated at 37 C for 60, 120 and 180 Minutes | 1 mg/ml | >58 | Plasma protease | LC-MS | Diluted plasma | In Vitro | None | EP 2023054305 W | EC50(nM) = 54.5 | |||
| N.A. | 2023 | SEQ ID NO 26 | 29 | Free | Free | Linear | L | X = Octanoyl-Dpr at position 3, Deg = Di-ethyl glycine at position 2 | Human Ghrelin Analog | Ghrelin Receptor Agonist | Solutions were incubated at 37 C for 60, 120 and 180 Minutes | 1 mg/ml | >58 | Plasma protease | LC-MS | Diluted plasma | In Vitro | None | EP 2023054305 W | EC50(nM) = 138 | |||
| N.A. | 2023 | SEQ ID NO 27 | 29 | Free | Free | Linear | L | X = Octanoyl-Dpr at position 3, Tie = L-te/t-butyl-glycine at position 2 | Human Ghrelin Analog | Ghrelin Receptor Agonist | Solutions were incubated at 37 C for 60, 120 and 180 Minutes | 1 mg/ml | >58 | Plasma protease | LC-MS | Diluted plasma | In Vitro | None | EP 2023054305 W | EC50(nM) = 61.8 | |||
| N.A. | 2023 | SEQ ID NO 28 | 29 | Free | Free | Linear | L | X = Octanoyl-Dpr at position 3, Aib = 2-aminoisobutyric acid at position 2 | Human Ghrelin Analog | Ghrelin Receptor Agonist | Solutions were incubated at 37 C for 60, 120 and 180 Minutes | 1 mg/ml | >58 | Plasma protease | LC-MS | Diluted plasma | In Vitro | None | EP 2023054305 W | EC50(nM) = 72.4 | |||
| N.A. | 2023 | SEQ ID NO 29 | 29 | Free | Free | Linear | L | X = Octanoyl-Dpr at position 3 | Human Ghrelin Analog | Ghrelin Receptor Agonist | Solutions were incubated at 37 C for 60, 120 and 180 Minutes | 1 mg/ml | >58 | Plasma protease | LC-MS | Diluted plasma | In Vitro | None | EP 2023054305 W | EC50(nM) = 36.6 | |||
| N.A. | 2023 | SEQ ID NO 30 | 29 | Free | Free | Linear | L | X = Octanoyl-Dpr at position 3 | Human Ghrelin Analog | Ghrelin Receptor Agonist | Solutions were incubated at 37 C for 60, 120 and 180 Minutes | 1 mg/ml | >58 | Plasma protease | LC-MS | Diluted plasma | In Vitro | None | EP 2023054305 W | EC50(nM) = 56.5 | |||
| N.A. | 2023 | SEQ ID NO 32 | 28 | Free | Free | Linear | L | X = Octanoyl-Dpr at position 2 | Human Ghrelin Analog | Ghrelin Receptor Agonist | Solutions were incubated at 37 C for 60, 120 and 180 Minutes | 1 mg/ml | >58 | Plasma protease | LC-MS | Diluted plasma | In Vitro | None | EP 2023054305 W | EC50(nM) = 142 | |||
| N.A. | 2023 | SEQ ID NO 33 | 29 | Free | Free | Linear | L | X = Octanoyl-Dpr at position 3, 1Nal = 3-(l-naphthyl)-L-alanine at position 4 | Human Ghrelin Analog | Ghrelin Receptor Agonist | Solutions were incubated at 37 C for 60, 120 and 180 Minutes | 1 mg/ml | >58 | Plasma protease | LC-MS | Diluted plasma | In Vitro | None | EP 2023054305 W | EC50(nM) = 61 | |||
| N.A. | 2023 | SEQ ID NO 34 | 29 | Free | Free | Linear | L | NMeS = N- methyl-L-serineat position 2,X = Octanoyl-Dpr at position 3, Nal = 3-(l-naphthyl)-L-alanine at position 4 | Human Ghrelin Analog | Ghrelin Receptor Agonist | Solutions were incubated at 37 C for 60, 120 and 180 Minutes | 1 mg/ml | 25 | Plasma protease | LC-MS | Diluted plasma | In Vitro | None | EP 2023054305 W | EC50(nM) = 27.2 | |||
| N.A. | 2023 | SEQ ID NO 35 | 29 | Free | Free | Linear | L | X = Octanoyl-Dpr at position 3 | Human Ghrelin Analog | Ghrelin Receptor Agonist | Solutions were incubated at 37 C for 60, 120 and 180 Minutes | 1 mg/ml | 63 | Plasma protease | LC-MS | Diluted plasma | In Vitro | None | EP 2023054305 W | EC50(nM) = 76.7 | |||
| N.A. | 2023 | SEQ ID NO 36 | 29 | Free | Free | Linear | L | X = Octanoyl-Dpr at position 3 | Human Ghrelin Analog | Ghrelin Receptor Agonist | Solutions were incubated at 37 C for 60, 120 and 180 Minutes | 1 mg/ml | >58 | Plasma protease | LC-MS | Diluted plasma | In Vitro | None | EP 2023054305 W | EC50(nM) = 44.5 | |||
| N.A. | 2023 | SEQ ID NO 37 | 29 | Free | Free | Linear | L | X = Octanoyl-Dpr at position 3 | Human Ghrelin Analog | Ghrelin Receptor Agonist | Solutions were incubated at 37 C for 60, 120 and 180 Minutes | 1 mg/ml | >58 | Plasma protease | LC-MS | Diluted plasma | In Vitro | None | EP 2023054305 W | EC50(nM) = 27.5 | |||
| N.A. | 2023 | SEQ ID NO 38 | 29 | Free | Free | Linear | L | X = Octanoyl-Dpr at position 3 | Human Ghrelin Analog | Ghrelin Receptor Agonist | Solutions were incubated at 37 C for 60, 120 and 180 Minutes | 1 mg/ml | >58 | Plasma protease | LC-MS | Diluted plasma | In Vitro | None | EP 2023054305 W | EC50(nM) = 56.1 | |||
| N.A. | 2023 | Parent compound 1 | 39 | Free | Free | Linear | L | Aib at position 2, Chem. 8 [2-[2-[2-[[2-[2-[2-[[(4S)-4-carboxy-4-(15- carboxypentadecanoylamino)butanoyl]amino]ethoxy]ethoxy]acetyl]amino]ethoxy]ethoxy] acetyl] attached to Lys33 | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 3 mg | 104 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | hGLP-1R, CRE Luc 0% HSA EC50(pM) = 2.1 | |||
| N.A. | 2023 | Parent compound 3 | 39 | Free | Free | Linear | L | Aib at position 2, Chem. 7 [(2S)-2-amino-6-[[(2S)-2-amino-6-[[(4S)-4-carboxy-4-(17-carboxyheptadecanoylamino)butanoyl]amino]hexanoyl]amino]hexanoyl] attached to Lys33 | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 2.9 mg | 131 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | hGLP-1R, CRE Luc 0% HSA EC50(pM) = 4 | |||
| N.A. | 2023 | Parent compound 4 | 39 | Free | Free | Linear | L | Aib at position 2, Chem. 7 [(2S)-2-amino-6-[[(2S)-2-amino-6-[[(4S)-4-carboxy-4-(17- carboxyheptadecanoylamino)butanoyl]amino]hexanoyl]amino]hexanoyl] attached to Lys16 | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 2.9 mg | 56 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | hGLP-1R, CRE Luc 0% HSA EC50(pM) = 4.2 | |||
| N.A. | 2023 | Parent compound 5 | 39 | Free | Amidation | Linear | L | Aib at position 2 and 13, Chem.16[2-[2-[2-[[2-[2-[2-[[(4S)-4-carboxy-4-(19- carboxynonadecanoylamino)butanoyl]amino]ethoxy]ethoxy]acetyl]amino]ethoxy]ethoxy] acetyl] attached to Lys | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 3 mg | 134 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | hGLP-1R, CRE Luc 0% HSA EC50(pM) = 9.7 | |||
| N.A. | 2023 | Non-converting compound 1 | 41 | Lys side chain conatins Chem. 16[(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl] attached to Lys1 | Free | Linear | L | Aib at position 4, Chem. 8[2-[2-[2-[[2-[2-[2-[[(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl]amino]ethoxy]ethoxy]acetyl]amino]ethoxy]ethoxy] acetyl] attached to Lys33 | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 2.8 mg | 137 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Non-converting compound 2 | 41 | Lys side chain conatins Chem. 16[(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl] attached to Lys1 | Free | Linear | L | Aib at position 4,Chem. 10[(2S)-2-amino-6-[[(2S)-2-amino-6-[[(4S)-4- carboxy-4-(15-carboxypentadecanoylamino)butanoyl]amino]hexanoyl]amino]hexanoyl] attached to Lys33 | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 3.5 mg | 130 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Non-converting compound 3 | 41 | Lys side chain conatins Chem. 16[(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl] attached to Lys1 , | Free | Linear | L | Aib at position 4,Chem. 7[(2S)-2-amino-6-[[(2S)-2-amino-6-[[(4S)-4-carboxy-4-(17-carboxyheptadecanoylamino)butanoyl]amino]hexanoyl]amino]hexanoyl] attached to Lys 16 | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 3 mg | 115 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Non-converting compound 4 | 41 | Lys side chain conatins Chem. 16[(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl attached to Lys1 | Amidation | Linear | L | Aib at position 4,Chem. 11[2-[2-[2-[[2-[2-[2-[[(4S)-4-carboxy-4-(19-carboxynonadecanoylamino)butanoyl]amino]ethoxy]ethoxy]acetyl]amino]ethoxy]ethoxy] acetyl] attached to Lys20 | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 3 mg | 136 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Compound 1 | 41 | D-Lys conjugated with [(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl] | Free | Linear | Mix | Chem. 8[2-[2-[2-[[2-[2-[2-[[(4S)-4-carboxy-4-(15- carboxypentadecanoylamino)butanoyl]amino]ethoxy]ethoxy]acetyl]amino]ethoxy]ethoxy] acetyl] attached to Lys33 , Sar2, Aib modifications | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 3.1 mg | 146 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Compound 2 | 41 | Free | Free | Linear | L | Aeg = N-(2-aminoethyl)glycine, Chem.16[(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl] attached to Aeg2, Chem.8[2-[2-[2-[[2-[2-[2-[[(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl]amino]ethoxy]ethoxy]acetyl]amino]ethoxy]ethoxy]acetyl] attached to Lys33 | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 2.9 mg | 142 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Compound 3 | 41 | Chem. 16 [(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl] attached to Lys1 | Free | Linear | L | Chem. 8[2-[2-[2-[[2-[2-[2-[[(4S)-4-carboxy-4-(15- carboxypentadecanoylamino)butanoyl]amino]ethoxy]ethoxy]acetyl]amino]ethoxy]ethoxy] acetyl] attached to Lys33, Sar2 modification | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 3 mg | 139 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Compound 5 | 41 | Chem. 16[(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl] attached to L-Aeg | Free | Linear | L | Chem. 8[2-[2-[2-[[2-[2-[2-[[(4S)-4-carboxy-4-(15- carboxypentadecanoylamino)butanoyl]amino]ethoxy]ethoxy]acetyl]amino]ethoxy]ethoxy] acetyl] attached to Lys33 | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 2.8 mg | 106 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Compound 12 | 41 | Chem. 16[(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl] attached to Lys1 | Free | Linear | L | Chem. 10[(2S)-2-amino-6-[[(2S)-2-amino-6-[[(4S)-4- carboxy-4-(15-carboxypentadecanoylamino)butanoyl]amino]hexanoyl]amino]hexanoyl] attached to Lys33, Sar2 modfications | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 2.7 mg | 143 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Compound 13 | 41 | Chem. 17[(4S)-4-carboxy-4-(17-carboxyheptadecanoylamino)butanoyl] attached to Lys1 | Free | Linear | L | Chem. 10[(2S)-2-amino-6-[[(2S)-2-amino-6-[[(4S)-4- carboxy-4-(15-carboxypentadecanoylamino)butanoyl]amino]hexanoyl]amino]hexanoyl] attached to Lys33, Sar2 modifications | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 2.8 mg | 121 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Compound 14 | 41 | Chem. 22[(2S)-2,6-bis[[(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl]amino]hexanoyl] attached to Lys1 | Free | Linear | L | Chem. 10[(2S)-2-amino-6-[[(2S)-2-amino-6-[[(4S)-4-carboxy-4-(15- carboxypentadecanoylamino)butanoyl]amino]hexanoyl]amino]hexanoyl] attached to Lys33, Sar2 modifications | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 3.2 mg | 119 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Compound 15 | 41 | Chem. 17[(4S)-4-carboxy-4-(17-carboxyheptadecanoylamino)butanoyl] attached to Lys1 | Free | Linear | L | Chem. 7[(2S)-2-amino-6-[[(2S)-2-amino-6-[[(4S)-4- carboxy-4-(17-carboxyheptadecanoylamino)butanoyl]amino]hexanoyl]amino]hexanoyl] attached to Lys33, Sar2 modifications | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 2 mg | 124 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Compound 16 | 41 | Chem. 16[(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl] attached to Lys1 | Free | Linear | L | Chem. 7[(2S)-2-amino-6-[[(2S)-2-amino-6-[[(4S)-4-carboxy-4-(17- carboxyheptadecanoylamino)butanoyl]amino]hexanoyl]amino]hexanoyl] attached to Lys 16, Sar2 modifications | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 2.9 mg | 96 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Compound 17 | 41 | Chem. 16 [(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl] attached to G-Aeg | Free | Linear | L | Chem.7[(2S)-2-amino-6-[[(2S)-2-amino-6-[[(4S)-4-carboxy-4-(17- carboxyheptadecanoylamino)butanoyl]amino]hexanoyl]amino]hexanoyl] attached to Lys16, Aib modifications | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 3.2 mg | 105 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Compound 18 | 41 | Chem. 16[(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl] attached to Lys1 | Amidation | Linear | L | Chem.11 [2-[2-[2-[[2-[2-[2-[[(4S)-4-carboxy-4-(19- carboxynonadecanoylamino)butanoyl]amino]ethoxy]ethoxy]acetyl]amino]ethoxy]ethoxy] acetyl] attached to Lys20, Sar2 modification | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 2.9 mg | 88 (Terminal Half Life) | Beagle dogs plasma protease | LC-MS | Beagle dogs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Parent compound 1 | 39 | Free | Free | Linear | L | Aib at position 2, Chem. 8 [2-[2-[2-[[2-[2-[2-[[(4S)-4-carboxy-4-(15- carboxypentadecanoylamino)butanoyl]amino]ethoxy]ethoxy]acetyl]amino]ethoxy]ethoxy] acetyl] attached to Lys33 | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 2 nmol/kg | 121 (Terminal Half Life) | Minipigs plasma protease | ELISA or similar antibody based assay or LC-MS | Minipigs plasma | In Vivo | None | EP 2023051315 W | hGLP-1R, CRE Luc 0% HSA EC50(pM) = 2.1 | |||
| N.A. | 2023 | Parent compound 2 | 39 | Free | Free | Linear | L | Aib at position 2, Chem. 10[(2S)-2-amino-6-[[(2S)-2-amino-6-[[(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl]amino]hexanoyl]amino]hexanoyl attached to Lys33 | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 1 nmol/kg | 104 (Terminal Half Life) | Minipigs plasma protease | ELISA or similar antibody based assay or LC-MS | Minipigs plasma | In Vivo | None | EP 2023051315 W | hGLP-1R, CRE Luc 0% HSA EC50(pM) = 1.5 | |||
| N.A. | 2023 | Parent compound 4 | 39 | Free | Free | Linear | L | Aib at position 2, Chem. 7 [(2S)-2-amino-6-[[(2S)-2-amino-6-[[(4S)-4-carboxy-4-(17- carboxyheptadecanoylamino)butanoyl]amino]hexanoyl]amino]hexanoyl] attached to Lys16 | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 1 nmol/kg | 106 (Terminal Half Life) | Minipigs plasma protease | ELISA or similar antibody based assay or LC-MS | Minipigs plasma | In Vivo | None | EP 2023051315 W | hGLP-1R, CRE Luc 0% HSA EC50(pM) = 4.2 | |||
| N.A. | 2023 | Non-converting compound 1 | 41 | Lys side chain conatins Chem. 16[(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl] attached to Lys1 | Free | Linear | L | Aib at position 4, Chem. 8[2-[2-[2-[[2-[2-[2-[[(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl]amino]ethoxy]ethoxy]acetyl]amino]ethoxy]ethoxy] acetyl] attached to Lys33 | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 2 nmol/kg | 170 (Terminal Half Life) | Minipigs plasma protease | ELISA or similar antibody based assay or LC-MS | Minipigs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Compound 1 | 41 | D-Lys conjugated with [(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl] | Free | Linear | Mix | Chem. 8[2-[2-[2-[[2-[2-[2-[[(4S)-4-carboxy-4-(15- carboxypentadecanoylamino)butanoyl]amino]ethoxy]ethoxy]acetyl]amino]ethoxy]ethoxy] acetyl] attached to Lys33 , Sar2 modification | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 20 nmol/kg | 118 (Terminal Half Life) | Minipigs plasma protease | ELISA or similar antibody based assay or LC-MS | Minipigs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Compound 3 | 41 | Chem. 16 [(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl] attached to Lys1 | Free | Linear | L | Chem. 8[2-[2-[2-[[2-[2-[2-[[(4S)-4-carboxy-4-(15- carboxypentadecanoylamino)butanoyl]amino]ethoxy]ethoxy]acetyl]amino]ethoxy]ethoxy] acetyl] attached to Lys33, Sar2 modifications | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 2 nmol/kg | 119 (Terminal Half Life) | Minipigs plasma protease | ELISA or similar antibody based assay or LC-MS | Minipigs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Compound 9 | 41 | Chem. 19[2-[[(4S)-4-carboxy-4-(15-carboxypentadecanoylamino)butanoyl]amino]acetyl] attached to Lys1 | Free | Linear | L | Chem. 8[2-[2-[2-[[2-[2-[2-[[(4S)-4-carboxy-4-(15- carboxypentadecanoylamino)butanoyl]amino]ethoxy]ethoxy]acetyl]amino]ethoxy]ethoxy] acetyl] attached to Lys33, Sar2 modifications | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 20 nmol/kg | 102 (Terminal Half Life) | Minipigs plasma protease | ELISA or similar antibody based assay or LC-MS | Minipigs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | Compound 10 | 41 | Chem. 21[2-[2-[2-[[2-[2-[2-[[(4S)-4-carboxy-4-(15- carboxypentadecanoylamino)butanoyl]amino]ethoxy]ethoxy]acetyl]amino]ethoxy]ethoxy] acetyl] attached to D-Lys1 | Free | Linear | Mix | Chem. 8[2-[2-[2-[[2-[2-[2-[[(4S)-4- carboxy-4-(15- carboxypentadecanoylamino)butanoyl]amino]ethoxy]ethoxy]acetyl]amino]ethoxy]ethoxy] acetyl] attached to Lys33 | Synthetic | GLP-1/GIP receptor co-agonist | N.A. | 20 nmol/kg | 118 (Terminal Half Life) | Minipigs plasma protease | ELISA or similar antibody based assay or LC-MS | Minipigs plasma | In Vivo | None | EP 2023051315 W | N.A. | |||
| N.A. | 2023 | TA-Alb23-Fc-ABDEG | 341 | Alb23 fused at the N-termini of both Fc domains of efgartigimod | Free | Linear | L | None | Synthetic | FcRN Antagonist | Blood sample were collected for Pk Measurement Ar : Test Day 1 (Td1)(Pre-Dosing), Td1(Prior To Dosing), Td1(5 Min), Td2(24 Hrs Post Dosing), Td3, Td4, Td6, Td8, Td11, Td15, Td18, Td22, Td29, Td36 And Td43 | 20 mg/kg | 27 | Cynomolgus monkeys serum protease | Sandwich ELISA | Cynomolgus monkeys serum | In Vivo | None | EP 2023066180 W | N.A. | |||
| N.A. | 2023 | TA-Alb23-Fc-ABDEG | 341 | Alb23 fused at the N-termini of both Fc domains of efgartigimod | Free | Linear | L | None | Synthetic | FcRN Antagonist | Blood sample were collected for PK measurement Ar : Test Day 1 (Td1)(Pre-Dosing), Td1(Prior To Dosing), Td1(5 Min), Td2(24 Hrs Post Dosing), Td3, Td4, Td6, Td8, Td11, Td15, Td18, Td22, Td29, Td36 And Td43 | 5 mg/kg | 28 ± 23 | Cynomolgus monkeys serum protease | Sandwich ELISA | Cynomolgus monkeys serum | In Vivo | None | EP 2023066180 W | N.A. | |||
| N.A. | 2023 | TA-Alb23-Fc-ABDEG | 341 | Alb23 fused at the N-termini of both Fc domains of efgartigimod | Free | Linear | L | None | Synthetic | FcRN Antagonist | Blood sample were collected for PK measurement Ar : Test Day 1 (Td1)(Pre-Dosing), Td1(Prior To Dosing), Td1(5 Min), Td2(24 Hrs Post Dosing), Td3, Td4, Td6, Td8, Td11, Td15, Td18, Td22, Td29, Td36 And Td43 | 20 mg/kg | 26.5 | C2 Cynomolgus monkeys serum protease | Sandwich ELISA | C2 Cynomolgus monkeys serum | In Vivo | None | EP 2023066180 W | N.A. | |||
| N.A. | 2023 | TA-Alb23-Fc-ABDEG | 341 | Alb23 fused at the N-termini of both Fc domains of efgartigimod | Free | Linear | L | None | Synthetic | FcRN Antagonist | Blood sample were collected for PK Measurement Ar : Test Day 1 (Td1)(Pre-Dosing), Td1(Prior To Dosing), Td1(5 Min), Td2(24 Hrs Post Dosing), Td3, Td4, Td6, Td8, Td11, Td15, Td18, Td22, Td29, Td36 And Td43 | 5 mg/kg | 13.4 | C4 Cynomolgus monkeys serum protease | Sandwich ELISA | C4 Cynomolgus monkeys serum | In Vivo | None | EP 2023066180 W | N.A. | |||
| N.A. | 2023 | TA-Alb23-Fc-ABDEG | 341 | Alb23 fused at the N-termini of both Fc domains of efgartigimod | Free | Linear | L | None | Synthetic | FcRN Antagonist | Blood sample were collected for PK measurement Ar : Test Day 1 (Td1)(Pre-Dosing), Td1(Prior To Dosing), Td1(5 Min), Td2(24 Hrs Post Dosing), Td3, Td4, Td6, Td8, Td11, Td15, Td18, Td22, Td29, Td36 And Td43 | 5 mg/kg | 54.4 | C5 Cynomolgus monkeys serum protease | Sandwich ELISA | C5 Cynomolgus monkeys serum | In Vivo | None | EP 2023066180 W | N.A. | |||
| N.A. | 2023 | TA-Alb23-Fc-ABDEG | 341 | Alb23 fused at the N-termini of both Fc domains of efgartigimod | Free | Linear | L | None | Synthetic | FcRN Antagonist | Blood sample were collected for PK Measurement Ar : Test Day 1 (Td1)(Pre-Dosing), Td1(Prior To Dosing), Td1(5 Min), Td2(24 Hrs Post Dosing), Td3, Td4, Td6, Td8, Td11, Td15, Td18, Td22, Td29, Td36 And Td43 | 5 mg/kg | 16.9 | C6 Cynomolgus monkeys serum protease | Sandwich ELISA | C6 Cynomolgus monkeys serum | In Vivo | None | EP 2023066180 W | N.A. | |||
| N.A. | 2023 | TA-Fc-ABDEG-Alb23 | 361 | Free | Alb23 fused at the C-termini of both Fc domains of ABDEG via a 20GS linker | Linear | L | None | Synthetic | FcRN Antagonist | N.A. | 30 mg/kg | 15 | G1-1 Cynomolgus monkeys serum protease | Sandwich ELISA | G1-1 Cynomolgus monkeys serum | In Vivo | None | EP 2023066180 W | N.A. | |||
| N.A. | 2023 | TA-Fc-ABDEG-Alb23 | 361 | Free | Alb23 fused at the C-termini of both Fc domains of ABDEG via a 20GS linker | Linear | L | None | Synthetic | FcRN Antagonist | N.A. | 30 mg/kg | 9.3 | G1-2 Cynomolgus monkeys serum protease | Sandwich ELISA | G1-2 Cynomolgus monkeys serum | In Vivo | None | EP 2023066180 W | N.A. | |||
| N.A. | 2023 | TA-Fc-ABDEG-Alb23 | 361 | Free | Alb23 fused at the C-termini of both Fc domains of ABDEG via a 20GS linker | Linear | L | None | Synthetic | FcRN Antagonist | N.A. | 30 mg/kg | 4.5 | G1-3 Cynomolgus monkeys serum protease | Sandwich ELISA | G1-3 Cynomolgus monkeys serum | In Vivo | None | EP 2023066180 W | N.A. | |||
| N.A. | 2023 | TA-Fc-ABDEG-Alb23 | 361 | Free | Alb23 fused at the C-termini of both Fc domains of ABDEG via a 20GS linker | Linear | L | None | Synthetic | FcRN Antagonist | N.A. | 75 mg/kg | 13 | G2-1 Cynomolgus monkeys serum protease | Sandwich ELISA | G2-1 Cynomolgus monkeys serum | In Vivo | None | EP 2023066180 W | N.A. | |||
| N.A. | 2023 | TA-Fc-ABDEG-Alb23 | 361 | Free | Alb23 fused at the C-termini of both Fc domains of ABDEG via a 20GS linker | Linear | L | None | Synthetic | Fcrn Antagonist | N.A. | 75 mg/kg | 6.1 | G2-2 Cynomolgus monkeys serum protease | Sandwich ELISA | G2-2 Cynomolgus monkeys serum | In Vivo | None | EP 2023066180 W | N.A. | |||
| N.A. | 2023 | TA-Fc-ABDEG-Alb23 | 361 | Free | Alb23 fused at the C-termini of both Fc domains of ABDEG via a 20GS linker | Linear | L | None | Synthetic | Fcrn Antagonist | N.A. | 75 mg/kg | 12 | G2-3 Cynomolgus monkeys serum protease | Sandwich ELISA | G2-3 Cynomolgus monkeys serum | In Vivo | None | EP 2023066180 W | N.A. | |||
| N.A. | 2023 | ZTPA001 | 108 | Free | ABD (albumin Binding Domain) | Linear | L | None | Tslp Binding Z Variants | Antiinflammatory | Blood samples (0.5 mL) were collected at the following time points: Predose, At 10 And 30 Min And 1 , 6, 10, 26, 50, 72, And 96 H Postdose And At Days 6, 7, 8, 11 , 13, 15, 18, And 22 | 1.33 mg/kg | 3-4 (Terminal Half Life) | Cynomolgus monkeys serum protease | Sandwich PK-ELISA | Cynomolgus monkeys serum | In Vivo | None | EP 2023053030 W | IC50(nM) = 0.5 | |||
| N.A. | 2023 | ZTPA104 | 111 | ABD (albumin Binding Domain) | Free | Linear | L | None | Tslp Binding Z Variants | Antiinflammatory | Blood sampling time points were divided into two cohorts as follows: Cohort A (N=3 Per Test Item) Were Bled Predose, At 5 Min And 1 , 8, 72, 168, 264, 408 And 504 H Postdose; And Cohort B (N=3 Per Test Item) Were Bled Predose, At 30 Min And 3, 24, 120, 216, 336 And 456 H Postdose | 1.2 mg/kg | 36 (Terminal Half Life) | SD rats serum protease | ELISA | SD rats serum | In Vivo | None | EP 2023053030 W | IC50(nM) = 0.03 | |||
| N.A. | 2023 | ZTPA001 | 108 | Free | ABD (albumin Binding Domain) | Linear | L | None | Tslp Binding Z Variants | Antiinflammatory | Blood sampling time points were divided into two cohorts as follows: Cohort A (N=3 Per Test Item) Were Bled Predose, At 5 Min And 1 , 8, 72, 168, 264, 408 And 504 H Postdose; And Cohort B (N=3 Per Test Item) Were Bled Predose, At 30 Min And 3, 24, 120, 216, 336 And 456 H Postdose | 1.2 mg/kg | 29 (Terminal Half Life) | SD rats serum protease | ELISA | SD rats serum | In Vivo | None | EP 2023053030 W | IC50(nM) = 0.5 | |||
| 36997003 | 2023 | HM15136 | 30 | IgG Fc linked at N terminus through MAL-PEG-ALD linker | Free | Cyclic (lactam bridge between E16-K20) | L | Aib2 modification | Synthetic | Treatment of Hyperinsulinemic Hypoglycemia | Blood (0.3 mL) was collected from the retro-orbital plexus at 0.25, 0.5, 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after IV administration | 260 μg/kg | 54.5 | Mouse serum protease | Modified ELISA | Mouse serum | In Vivo | https://www.nature.com/articles/s41598-022-21251-y | None | EC50 of HM15136 was 0.024 ± 0.006 nM while that of native glucagon was 0.003 ± 0.001 nM for hGCGR | |||
| 36997003 | 2023 | HM15136 | 30 | IgG Fc linked at N terminus through MAL-PEG-ALD linker | Free | Cyclic (lactam bridge between E16-K20) | L | Aib2 modification | Synthetic | Treatment of Hyperinsulinemic Hypoglycemia | Blood (0.3 mL) was collected from the retro-orbital plexus at 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after SC administration | 260 μg/kg | 32.3 | Mouse serum protease | Modified ELISA | Mouse serum | In Vivo | https://www.nature.com/articles/s41598-022-21251-y | None | EC50 of HM15136 was 0.024 ± 0.006 nM while that of native glucagon was 0.003 ± 0.001 nM for hGCGR | |||
| 36997003 | 2023 | HM15136 | 30 | IgG Fc linked at N terminus through MAL-PEG-ALD linker | Free | Cyclic (lactam bridge between E16-K20) | L | Aib2 modification | Synthetic | Treatment of Hyperinsulinemic Hypoglycemia | Blood (0.3 mL) was collected from the retro-orbital plexus at 0.25, 0.5, 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after IV administration | 260 μg/kg | 66.4 ± 33.0 | Rats serum protease | Modified ELISA | Rats serum | In Vivo | https://www.nature.com/articles/s41598-022-21251-y | None | EC50 of HM15136 was 0.024 ± 0.006 nM while that of native glucagon was 0.003 ± 0.001 nM for hGCGR | |||
| 36997003 | 2023 | HM15136 | 30 | IgG Fc linked at N terminus through MAL-PEG-ALD linker | Free | Cyclic (lactam bridge between E16-K20) | L | Aib2 modification | Synthetic | Treatment of Hyperinsulinemic Hypoglycemia | Blood (0.3 mL) was collected from the retro-orbital plexus at 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after SC administration | 260 μg/kg | 40.9 ± 17.7 | Rats serum protease | Modified ELISA | Rats serum | In Vivo | https://www.nature.com/articles/s41598-022-21251-y | None | EC50 of HM15136 was 0.024 ± 0.006 nM while that of native glucagon was 0.003 ± 0.001 nM for hGCGR | |||
| 36997003 | 2023 | HM15136 | 30 | IgG Fc linked at N terminus through MAL-PEG-ALD linker | Free | Cyclic (lactam bridge between E16-K20) | L | Aib2 modification | Synthetic | Treatment of Hyperinsulinemic Hypoglycemia | Blood (0.3 mL) was collected from the retro-orbital plexus at 0.25, 0.5, 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after IV administration | 52 μg/kg | 24.9 ± 2.2 | Dogs serum protease | Modified ELISA | Dogs serum | In Vivo | https://www.nature.com/articles/s41598-022-21251-y | None | EC50 of HM15136 was 0.024 ± 0.006 nM while that of native glucagon was 0.003 ± 0.001 nM for hGCGR | |||
| 36997003 | 2023 | HM15136 | 30 | IgG Fc linked at N terminus through MAL-PEG-ALD linker | Free | Cyclic (lactam bridge between E16-K20) | L | Aib2 modification | Synthetic | Treatment of Hyperinsulinemic Hypoglycemia | Blood (0.3 mL) was collected from the retro-orbital plexus at 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after SC administration | 52 μg/kg | 26.6 ± 1.5 | Dogs serum protease | Modified ELISA | Dogs serum | In Vivo | https://www.nature.com/articles/s41598-022-21251-y | None | EC50 of HM15136 was 0.024 ± 0.006 nM while that of native glucagon was 0.003 ± 0.001 nM for hGCGR | |||
| 36997003 | 2023 | HM15136 | 240 | Free | HMC001 | Cyclic (E36-K40 lactam bridge in GCG analog) | L | Aib, GC15136 and HMC001 are linked via a 10-kDa, bifunctional maleimide-polyethylene glycol-aldehyde (MAL-PEG-ALD) linker | Glucagon analog | Treatment of Congenital Hyperinsulinism | Blood (0.3 mL) was collected from the retro-orbital plexus at 0.25, 0.5, 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after IV administration and at 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after SC administration of HM15136 | 260 μg/kg | 54.5 | Mouse serum protease | ELISA | Mouse serum | In Vivo | PDB id: 5HVW, https://pubmed.ncbi.nlm.nih.gov/36202918/ | None | KD (HM15136) = No binding for FcγRIA, FcγRIIA, FcγRIIB/C, FcγRIIIA, FcγRIIIB, C1q | |||
| 36997003 | 2023 | HM15136 | 240 | Free | HMC001 | Cyclic (E36-K40 lactam bridge in GCG analog) | L | Aib, GC15136 and HMC001 are linked via a 10-kDa, bifunctional maleimide-polyethylene glycol-aldehyde (MAL-PEG-ALD) linker | Glucagon analog | Treatment of Congenital Hyperinsulinism | Blood (0.3 mL) was collected from the retro-orbital plexus at 0.25, 0.5, 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after IV administration and at 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after SC administration of HM15136 | 260 μg/kg | 32.3 | Mouse serum protease | ELISA | Mouse serum | In Vivo | PDB id: 5HVW, https://pubmed.ncbi.nlm.nih.gov/36202918/ | None | KD (HM15136) = No binding for FcγRIA, FcγRIIA, FcγRIIB/C, FcγRIIIA, FcγRIIIB, C1q | |||
| 36997003 | 2023 | HM15136 | 240 | Free | HMC001 | Cyclic (E36-K40 lactam bridge in GCG analog) | L | Aib, GC15136 and HMC001 are linked via a 10-kDa, bifunctional maleimide-polyethylene glycol-aldehyde (MAL-PEG-ALD) linker | Glucagon analog | Treatment of Congenital Hyperinsulinism | Blood (0.3 mL) was collected from the retro-orbital plexus at 0.25, 0.5, 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after IV administration and at 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after SC administration of HM15136 | 260 μg/kg | 66.4 ± 33.0 | Rats serum protease | ELISA | Rats serum | In Vivo | PDB id: 5HVW, https://pubmed.ncbi.nlm.nih.gov/36202918/ | None | KD (HM15136) = No binding for FcγRIA, FcγRIIA, FcγRIIB/C, FcγRIIIA, FcγRIIIB, C1q | |||
| 36997003 | 2023 | HM15136 | 240 | Free | HMC001 | Cyclic (E36-K40 lactam bridge in GCG analog) | L | Aib, GC15136 and HMC001 are linked via a 10-kDa, bifunctional maleimide-polyethylene glycol-aldehyde (MAL-PEG-ALD) linker | Glucagon analog | Treatment of Congenital Hyperinsulinism | Blood (0.3 mL) was collected from the retro-orbital plexus at 0.25, 0.5, 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after IV administration and at 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after SC administration of HM15136 | 260 μg/kg | 40.9 ± 17.7 | Rats serum protease | ELISA | Rats serum | In Vivo | PDB id: 5HVW, https://pubmed.ncbi.nlm.nih.gov/36202918/ | None | KD (HM15136) = No binding for FcγRIA, FcγRIIA, FcγRIIB/C, FcγRIIIA, FcγRIIIB, C1q | |||
| 36997003 | 2023 | HM15136 | 240 | Free | HMC001 | Cyclic (E36-K40 lactam bridge in GCG analog) | L | Aib, GC15136 and HMC001 are linked via a 10-kDa, bifunctional maleimide-polyethylene glycol-aldehyde (MAL-PEG-ALD) linker | Glucagon analog | Treatment of Congenital Hyperinsulinism | Blood (0.3 mL) was collected from the retro-orbital plexus at 0.25, 0.5, 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after IV administration and at 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after SC administration of HM15136 | 52 μg/kg | 24.9 ± 2.2 | Dogs serum protease | ELISA | Dogs serum | In Vivo | PDB id: 5HVW, https://pubmed.ncbi.nlm.nih.gov/36202918/ | None | KD (HM15136) = No binding for FcγRIA, FcγRIIA, FcγRIIB/C, FcγRIIIA, FcγRIIIB, C1q | |||
| 36997003 | 2023 | HM15136 | 240 | Free | HMC001 | Cyclic (E36-K40 lactam bridge in GCG analog) | L | Aib, GC15136 and HMC001 are linked via a 10-kDa, bifunctional maleimide-polyethylene glycol-aldehyde (MAL-PEG-ALD) linker | Glucagon analog | Treatment of Congenital Hyperinsulinism | Blood (0.3 mL) was collected from the retro-orbital plexus at 0.25, 0.5, 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after IV administration and at 1, 4, 8, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240, 264, 288, 312, and 336 h after SC administration of HM15136 | 52 μg/kg | 26.6 ± 1.5 | Dogs serum protease | ELISA | Dogs serum | In Vivo | PDB id: 5HVW, https://pubmed.ncbi.nlm.nih.gov/36202918/ | None | KD (HM15136) = No binding for FcγRIA, FcγRIIA, FcγRIIB/C, FcγRIIIA, FcγRIIIB, C1q | |||
| 36588717 | 2022 | [3H]BPC157 | 15 | Free | Free | Linear | L | all Proline radiolabelled with [3H] | Isolated from human gastric juice | Treatment of various wounds in rats and dogs | Whole blood and plasma samples of six JVC rats were collected at 0.05, 0.167, 0.5, 1, 2, 4, 8, 24, 48, and 72 h after administration (three males and three females at each time point) for the examination of radio pharmacokinetics of total plasma | 100 µg/300 μCi/kg | 102 ± 32 | JVC rats plasma protease | Liquid scintillation counter | JVC Rats plasma | In Vivo | None | None | N.A. | |||
| 36323988 | 2022 | Glepaglutide | 33 | Free | Free | Linear | L | None | GLP-2 analogue | Treatment of Short Bowel Syndrome | blood sampling in subjects receiving 5 and 10 mg of glepaglutide once weekly occurred at the day 1 visit (pre-dose and 0.5, 1, 2, 4, 8, 12, 16, 20, 24, 36, 48, 60, 72, 96 and 120 h post-dose); pre-dose on days 8, 15, 22 and 29; and in connection with the last dosing visit on day 36 (pre-dose and 0.5, 1, 2, 4, 8, 12, 16, 20, 24, 36, 48, 72, 120, 168, 336, 504, 672 and 840 h post-dose) | 5 mg | 228 | Human plasma protease | LC-MS | Human plasma after SC glepaglutide 5 mg after 6 once-weekly doses | In Vivo | None | None | EC50 = 0.12 nM In vitro potency | |||
| 36323988 | 2022 | Glepaglutide M2 | 34 | Free | 1 lysines has been added at C terminal | Linear | L | None | GLP-2 analogue | Treatment of Short Bowel Syndrome | blood sampling in subjects receiving 5 and 10 mg of glepaglutide once weekly occurred at the day 1 visit (pre-dose and 0.5, 1, 2, 4, 8, 12, 16, 20, 24, 36, 48, 60, 72, 96 and 120 h post-dose); pre-dose on days 8, 15, 22 and 29; and in connection with the last dosing visit on day 36 (pre-dose and 0.5, 1, 2, 4, 8, 12, 16, 20, 24, 36, 48, 72, 120, 168, 336, 504, 672 and 840 h post-dose) | 5 mg | 231 | Human plasma protease | LC-MS | Human plasma after SC glepaglutide 5 mg after 6 once-weekly doses | In Vivo | None | None | EC50 = 0.044 nM In vitro potency | |||
| 36323988 | 2022 | Glepaglutide | 33 | Free | Free | Linear | L | None | GLP-2 analogue | Treatment of Short Bowel Syndrome | blood sampling in subjects receiving 5 and 10 mg of glepaglutide once weekly occurred at the day 1 visit (pre-dose and 0.5, 1, 2, 4, 8, 12, 16, 20, 24, 36, 48, 60, 72, 96 and 120 h post-dose); pre-dose on days 8, 15, 22 and 29; and in connection with the last dosing visit on day 36 (pre-dose and 0.5, 1, 2, 4, 8, 12, 16, 20, 24, 36, 48, 72, 120, 168, 336, 504, 672 and 840 h post-dose) | 10 mg | 254 | Human plasma protease | LC-MS | Human plasma after SC glepaglutide 5 mg after 6 once-weekly doses | In Vivo | None | None | EC50 = 0.12 nM In vitro potency | |||
| 36323988 | 2022 | Glepaglutide M1 | 35 | Free | Two lysines has been added at C terminal | Linear | L | None | GLP-2 analogue | Treatment of Short Bowel Syndrome | blood sampling in subjects receiving 5 and 10 mg of glepaglutide once weekly occurred at the day 1 visit (pre-dose and 0.5, 1, 2, 4, 8, 12, 16, 20, 24, 36, 48, 60, 72, 96 and 120 h post-dose); pre-dose on days 8, 15, 22 and 29; and in connection with the last dosing visit on day 36 (pre-dose and 0.5, 1, 2, 4, 8, 12, 16, 20, 24, 36, 48, 72, 120, 168, 336, 504, 672 and 840 h post-dose) | 10 mg | 37.7 | Human plasma protease | LC-MS | Human plasma after SC glepaglutide 5 mg after 6 once-weekly doses | In Vivo | None | None | EC50 = 0.068 nM In vitro potency | |||
| 36323988 | 2022 | Glepaglutide M2 | 34 | Free | 1 lysines has been added at C terminal | Linear | L | None | GLP-2 analogue | Treatment of Short Bowel Syndrome | blood sampling in subjects receiving 5 and 10 mg of glepaglutide once weekly occurred at the day 1 visit (pre-dose and 0.5, 1, 2, 4, 8, 12, 16, 20, 24, 36, 48, 60, 72, 96 and 120 h post-dose); pre-dose on days 8, 15, 22 and 29; and in connection with the last dosing visit on day 36 (pre-dose and 0.5, 1, 2, 4, 8, 12, 16, 20, 24, 36, 48, 72, 120, 168, 336, 504, 672 and 840 h post-dose) | 10 mg | 255 | Human plasma protease | LC-MS | Human plasma after SC glepaglutide 5 mg after 6 once-weekly doses | In Vivo | None | None | EC50 = 0.044 nM In vitro potency | |||
| 36323988 | 2022 | Glepaglutide | 33 | Free | Free | Linear | L | None | GLP-2 analogue | Treatment of Short Bowel Syndrome | blood sampling in subjects receiving 5 and 10 mg of glepaglutide once weekly occurred at the day 1 visit (pre-dose and 0.5, 1, 2, 4, 8, 12, 16, 20, 24, 36, 48, 60, 72, 96 and 120 h post-dose); pre-dose on days 8, 15, 22 and 29; and in connection with the last dosing visit on day 36 (pre-dose and 0.5, 1, 2, 4, 8, 12, 16, 20, 24, 36, 48, 72, 120, 168, 336, 504, 672 and 840 h post-dose) | 10 mg | 88.3 | Human plasma protease | LC-MS | Human plasma after SC glepaglutide 5 mg after 6 once-weekly doses | In Vivo | None | None | EC50 = 0.044 nM In vitro potency | |||
| 36142749 | 2022 | PK20 | 10 | Replacing tyrosine (Tyr) with 2,6-dimethyltyrosine (Dmt) at position 1 | Free | Linear | Mix | D-amino acid residue (D-Lys) inserted at position 2 | opioid–neurotensin hybrid peptide | Analgesic | 37°C for 24 h | 50 μg/mL | 204.4 | N.A. | LC-MS | 1M HCl | In Vitro | None | None | Emax = 149.17% ± 2.9 for PK20 (intrinsic activity of the receptor) | |||
| 36142749 | 2022 | [Ile9]PK20 | 10 | Replacing tyrosine (Tyr) with 2,6-dimethyltyrosine (Dmt) at position 1 | Free | Linear | Mix | D-amino acid residue (D-Lys) inserted at position 2 | PK20 derivative | Analgesic | 37°C for 24 h | 50 μg/mL | 117.7 | N.A. | LC-MS | 1M HCl | In Vitro | None | None | Emax = 151.2% ± 74.5 for [Ile9]PK20 (intrinsic activity of the receptor) | |||
| 36135098 | 2022 | GNRs-AAP1-Cy5 | 7 | Free | Free | Linear | L | Cy5 conjugation | AAP1/AAP1-1/AAP1-2 modified GNRs | Antiadhesive property | At 0, 0.08, 0.16, 0.33, 0.5, 1, 2, 6, 12, 24, 48, 72 h, adding 40 μL termination solution | 1 mg/ml | 37.81 (T1/2 b ) | Mouse serum protease | HPLC | 1 mL mouse serum | In Vitro | None | None | N.A. | |||
| 36112771 | 2022 | BT8009 | 16 | Acetylation | Conjugation to MMAE cytotoxin via a valine–citrulline (V-Citr) cleavable linker,Val-Citriline linker and BTC joined by spacer Sar10 | Bicyclic | Mix | cyclised on TATA (1,3,5-Triacryloylhexahydro-1,3,5-triazine), 1Nal - 3-(1-naphthyl)-L-alanine, HArg – homo-arginine, HyP – hydroxyproline, MMAE = Monomethyl auristatin E, Cys16 with amidation modification, D-Asp4 modification | BT8009 and MMAE cytotoxin hybrid | Anticancer | 24 hours | 2 µM | >57.8 | Human plasma protease | LC-MS/MS | Human plasma | In Vitro | None | None | KD(nM) = 2.5±1.3 (Binding affinity for BT8009 binding to extracellular domains of Nectin-4 in human) | |||
| 36112771 | 2022 | BT8009 | 16 | Acetylation | Conjugation to MMAE cytotoxin via a valine–citrulline (V-Citr) cleavable linker,Val-Citriline linker and BTC joined by spacer Sar10 | Bicyclic | Mix | cyclised on TATA (1,3,5-Triacryloylhexahydro-1,3,5-triazine), 1Nal - 3-(1-naphthyl)-L-alanine, HArg – homo-arginine, HyP – hydroxyproline, MMAE = Monomethyl auristatin E, Cys16 with amidation modification, D-Asp4 modification | BT8009 and MMAE cytotoxin hybrid | Anticancer | 24 hours | 2 µM | >57.8 | NHP plasma protease | LC-MS/MS | NHP plasma | In Vitro | None | None | KD(nM) = 6.3±1.3 (Binding affinity for BT8009 binding to extracellular domains of Nectin-4 in NHP) | |||
| 36112771 | 2022 | BT8009 | 16 | Acetylation | Conjugation to MMAE cytotoxin via a valine–citrulline (V-Citr) cleavable linker,Val-Citriline linker and BTC joined by spacer Sar10 | Bicyclic | Mix | cyclised on TATA (1,3,5-Triacryloylhexahydro-1,3,5-triazine), 1Nal - 3-(1-naphthyl)-L-alanine, HArg – homo-arginine, HyP – hydroxyproline, MMAE = Monomethyl auristatin E, Cys16 with amidation modification, D-Asp4 modification | BT8009 and MMAE cytotoxin hybrid | Anticancer | 24 hours | 2 µM | 60.7 | Rats plasma protease | LC-MS/MS | Rats plasma | In Vitro | None | None | KD(nM) = 6.0±1.2 (Binding affinity for BT8009 binding to extracellular domains of Nectin-4 in Rat) | |||
| 36112771 | 2022 | BT8009 | 16 | Acetylation | Conjugation to MMAE cytotoxin via a valine–citrulline (V-Citr) cleavable linker,Val-Citriline linker and BTC joined by spacer Sar10 | Bicyclic | Mix | cyclised on TATA (1,3,5-Triacryloylhexahydro-1,3,5-triazine), 1Nal - 3-(1-naphthyl)-L-alanine, HArg – homo-arginine, HyP – hydroxyproline, MMAE = Monomethyl auristatin E, Cys16 with amidation modification, D-Asp4 modification | BT8009 and MMAE cytotoxin hybrid | Anticancer | 24 hours | 2 µM | 26.1 | Human blood Protease | LC-MS/MS | Human blood sample | In Vitro | None | None | KD(nM) = 2.5±1.3 (Binding affinity for BT8009 binding to extracellular domains of Nectin-4 in human) | |||
| 36112771 | 2022 | BT8009 | 16 | Acetylation | Conjugation to MMAE cytotoxin via a valine–citrulline (V-Citr) cleavable linker,Val-Citriline linker and BTC joined by spacer Sar10 | Bicyclic | Mix | cyclised on TATA (1,3,5-Triacryloylhexahydro-1,3,5-triazine), 1Nal - 3-(1-naphthyl)-L-alanine, HArg – homo-arginine, HyP – hydroxyproline, MMAE = Monomethyl auristatin E, Cys16 with amidation modification, D-Asp4 modification | BT8009 and MMAE cytotoxin hybrid | Anticancer | 24 hours | 2 µM | 28.3 | NHP blood protease | LC-MS/MS | NHP blood sample | In Vitro | None | None | KD(nM) = 6.3±1.3 (Binding affinity for BT8009 binding to extracellular domains of Nectin-4 in NHP) | |||
| 36101452 | 2022 | IgG1 S-AM (6-52) | 47 | IgG1 Fc linked with hAM using linker (GGGGS)3 | Amidation | Cyclic (C16-C21 Disulfide Bond In Ham) | L | None | hAM-IgG Fc fusion protein | AntiiInflammatory | Blood was collected before injection (day 0), and then 1, 2, 4, 6, 8, 10, 12, and 14 days after administration | 30 nmol/kg | 2.11 | Wistar rats plasma protease | ELISA (measure mAM) | Wistar rats plasma | In Vivo | None | None | After treatment with IgG4-AM (6-52), SBP (Systolic Blood Pressure) decreased significantly over time, showing reductions of 24.3 ± 4.8 mmHg on day 3, 32.2 ± 6.9 mmHg on day 6, 40.7 ± 3.1 mmHg on day 9, and 56.6 ± 4.5 mmHg on day 12, compared to the control group | |||
| 36101452 | 2022 | IgG4 S-AM (6-52) | 47 | IgG4 Fc linked with hAM using linker (GGGGS)3 | Amidation | Linear | L | None | hAM-IgG Fc fusion protein | AntiiInflammatory | Blood was collected before injection (day 0), and then 1, 2, 4, 6, 8, 10, 12, and 14 days after administration | 30 nmol/kg | 2.37 | Wistar rats plasma protease | ELISA (measure mAM ) | Wistar rats plasma | In Vivo | None | None | After treatment with IgG4-AM (6-52), SBP (Systolic Blood Pressure) decreased significantly over time, showing reductions of 24.3 ± 4.8 mmHg on day 3, 32.2 ± 6.9 mmHg on day 6, 40.7 ± 3.1 mmHg on day 9, and 56.6 ± 4.5 mmHg on day 12, compared to the control group | |||
| 36101452 | 2022 | IgG1 S-AM (6-52) | 47 | IgG1 Fc linked with hAM using linker (GGGGS)3 | Amidation | Cyclic (C16-C21 Disulfide Bond In Ham) | L | None | hAM-IgG Fc fusion protein | AntiiInflammatory | Blood was collected before injection (day 0), and then 1, 2, 4, 6, 8, 10, 12, and 14 days after administration | 30 nmol/kg | 2.885 | Wistar rats plasma protease | ELISA (measure tAM ) | Wistar rats plasma | In Vivo | None | None | After treatment with IgG4-AM (6-52), SBP (Systolic Blood Pressure) decreased significantly over time, showing reductions of 24.3 ± 4.8 mmHg on day 3, 32.2 ± 6.9 mmHg on day 6, 40.7 ± 3.1 mmHg on day 9, and 56.6 ± 4.5 mmHg on day 12, compared to the control group | |||
| 36101452 | 2022 | IgG4 S-AM (6-52) | 47 | IgG4 Fc linked with hAM using linker (GGGGS)3 | Amidation | Linear | L | None | hAM-IgG Fc fusion protein | AntiiInflammatory | Blood was collected before injection (day 0), and then 1, 2, 4, 6, 8, 10, 12, and 14 days after administration | 30 nmol/kg | 3.23 | Wistar rats plasma protease | ELISA (measure tAM ) | Wistar rats plasma | In Vivo | None | None | After treatment with IgG4-AM (6-52), SBP (Systolic Blood Pressure) decreased significantly over time, showing reductions of 24.3 ± 4.8 mmHg on day 3, 32.2 ± 6.9 mmHg on day 6, 40.7 ± 3.1 mmHg on day 9, and 56.6 ± 4.5 mmHg on day 12, compared to the control group | |||
| 36075899 | 2022 | S-20-1 | N.A. | N.A. | N.A. | Cyclic | L | Modified by adding negative charge | Synthetic | Antiviral (Against Infection By Sars-Cov-2 ) | Blood samples were collected at 10 min, 20 min, 30 min, 1 h, 2 h, 4 h, 8 h, 24 h and 48 h | 50 mg/kg | 24.29 (Terminal Elimination Half Life) | C57Bl/6 mice plasma protease | LC-MS/MS | C57BL/6 mice plasma | In Vivo | None | None | IC50 (μM) = 0.8 in HUH 7 cells | |||
| 35999612 | 2022 | cRGD-Exo/TP | 3 | DSPE-PEG | Free | Cyclic (RGD) | L | DiR labeled | Synthetic | Targeted delivery of triptolide against malignant melanoma | Scanned at interval times (1, 2, 4, 6, 12, and 24 h) | N.A. | 27.14 ± 2.55 | Mice plasma protease | IVIS at 750/780 nm | BALB/c nude mice plasma | In Vivo | None | None | Tumor inhibition rate of 65.73 ± 3.29% in the cRGD-Exo/TP | |||
| 35971165 | 2022 | Au‐AR pep‐PROTAC | 33 | Free | Free | Linear | L | None | Synthetic | Anticancer (Prostate Cancer Therapy) | N.A. | N.A. | 26.3 | Mouse serum protease | ICP‐MS | mouse serum | In Vivo | None | None | N.A. | |||
| 35971165 | 2022 | Au‐AR pep‐PROTAC | 33 | Free | Free | Linear | L | None | Synthetic | Anticancer (Prostate Cancer Therapy) | N.A. | N.A. | 25.1 | PBS containing 10% serum protease | HPLC | PBS containing 10% serum | In Vitro | None | None | IC50 of Au‐AR pep‐PROTAC on AML 12 cells is 2.41 µM | |||
| 35892256 | 2022 | RA15127343 | 51 | Free | Free | Linear | L | Albumin binding fatty-acid side chain is coupled to lysine (B29) | Insulin analogue | Antidiabetes | Blood samples were collected before RA15127343 administration (baseline) and 1–4 times per day until study end. | 10 nmol/kg | 47 | Göttingen minipigs plasma protease | LC-MS/MS | Göttingen minipigs plasma | In Vivo | https://sci-hub.st/10.1016/j.jpba.2018.07.009 | None | (Activity values of RA15127343) IC50 for IR-A: 19.9 μM, IC50 for IR-B: 6.31 μM, EC50 for IR-A: 2.054 μM, EC50 for IR-B: 669.6 nM | |||
| 35892256 | 2022 | RA15127343 | 51 | Free | Free | Linear | L | Albumin binding fatty-acid side chain is coupled to lysine (B29) | Insulin analogue | Antidiabetes | Blood samples were collected before RA15127343 administration (baseline) and 1–4 times per day until study end. | 10,30,45,60 nmol/kg | 48 - 59 | Göttingen minipigs plasma protease | LC-MS/MS | Göttingen minipigs plasma | In Vivo | https://sci-hub.st/10.1016/j.jpba.2018.07.009 | None | (Activity values of RA15127343) IC50 for IR-A: 19.9 μM, IC50 for IR-B: 6.31 μM, EC50 for IR-A: 2.054 μM, EC50 for IR-B: 669.6 nM | |||
| 35858423 | 2022 | 4A | 38 | 3A coupled to bicyclononyne-modified MSs (MS-N-hydroxysuccinymidocarbonates) | Free | Linear | L | Gln 6,14 modification, Mod = (CH3)2CHSO2-, N3-linker N-hydroxysuccinymidocarbonates containing isopropyl sulfone (1A) and N,N-dimethyl-sulfonamide (1B) modulators | MS-[Gln6,14]CNP-38 conjugate | Treatment of Achondroplasia | Blood samples (~100 μL) were drawn from the tail vein at 8, 24, 48, 72, 120, 168, 240, 336, 432, 504, 600 and 672 h on a staggered schedule from 12 mice to give 4 replicates at each time-point | 20 nmol | 40 (T1/2,a -Elimination Half Life) | CD1 mice plasma protease | ELISA, LC-MS/MS | CD1 mice plasma | In Vivo | None | None | QWk 50 nmol of 4A caused significantly increased growth, with mice becoming about 25% longer than the vehicle control over the study period | |||
| 35858423 | 2022 | 4B | 38 | 3B coupled to bicyclononyne-modified MSs (MS-N-hydroxysuccinymidocarbonates) | Free | Linear | L | Gln 6,14 modification, Mod = (CH3)2CHSO2-, N3-linker N-hydroxysuccinymidocarbonates containing N,N-dimethyl-sulfonamide (1B) modulators | MS-[Gln6,14]CNP-38 conjugate | Treatment of Achondroplasia | Blood samples (~100 μL) were drawn from the tail vein at 8, 24, 24, 96, 168, 240, 336, 408, 504, 576, 672, 840, 1008, 1176, 1344, and 1512 h from 8 mice on a staggered schedule to give 4 replicates at each time-point | 700 nmol | 60 ( T1/2,a - Elimination Half Life) | CD1 mice plasma protease | ELISA, LC-MS/MS | CD1 mice plasma | In Vivo | None | None | Single dose of 85 nmol of 4B showed similar growth stimulation as QD administration of [Gln6,14]CNP-38 for 3 weeks, but growth plateaued afterward | |||
| 35858423 | 2022 | 4A | 38 | 3A coupled to bicyclononyne-modified MSs (MS-N-hydroxysuccinymidocarbonates) | Free | Linear | L | Gln 6,14 modification, Mod = (CH3)2CHSO2- | MS-[Gln6,14]CNP-38 conjugate | Treatment of Achondroplasia | Blood samples (~100 μL) were drawn from the tail vein at 8, 24, 48, 72, 120, 168, 240, 336, 432, 504, 600 and 672 h on a staggered schedule from 12 mice to give 4 replicates at each time-point | 20 nmol | 212 (T1/2,b-Elimination Half Life) | CD1 mice plasma protease | ELISA, LC-MS/MS | CD1 mice plasma | In Vivo | None | None | QWk 50 nmol of 4A caused significantly increased growth, with mice becoming about 25% longer than the vehicle control over the study period | |||
| 35858423 | 2022 | 4B | 38 | 3B coupled to bicyclononyne-modified MSs (MS-N-hydroxysuccinymidocarbonates) | Free | Linear | L | Gln 6,14 modification, Mod = (CH3)2NSO2- | MS-[Gln6,14]CNP-38 conjugate | Treatment of Achondroplasia | Blood samples (~100 μL) were drawn from the tail vein at 8, 24, 24, 96, 168, 240, 336, 408, 504, 576, 672, 840, 1008, 1176, 1344, and 1512 h from 8 mice on a staggered schedule to give 4 replicates at each time-point | 700 nmol | 610 ( T1/2,b-Elimination Half Life) | CD1 mice plasma protease | ELISA, LC-MS/MS | CD1 mice plasma | In Vivo | None | None | Single dose of 85 nmol of 4B showed similar growth stimulation as QD administration of [Gln6,14]CNP-38 for 3 weeks, but growth plateaued afterward | |||
| 35840338 | 2022 | BIF | 296 | Single-chain variant of insulin has modifications:TyrB16Glu,PheB25His,ThrB27Gly,ProB28Gly,LysB29Gly,ThrB30Gly,IleA10Thr,TyrA14Asp,AsnA21Gly, single-chain variant of insulin with B-chain linked to A-chain by a short linker (Linker 1) | Interdomain linker (Linker 2) connecting the A-chain of insulin to the Fc and the Fc domain from IgG2 | Linear | L | None | Fc-fusion protein | Antidiabetes | Blood samples for glucose measurements were collected by tail bleed conducted under brief restraint. Blood glucose was measured preinjection, 1, 2, 4, 6, 8, 10, 12, 24, 48, 72, 96, 120,144, 168, 240, and 336 hours postdose | 3 nmol/kg | 128 ± 10 | Streptozotocin STZ-treated diabetic SD rats blood protease | Insulin receptor ELISA | Streptozotocin STZ-treated diabetic SD rats blood sample | In Vivo | None | None | Receptor Phosphorylation EC50, nM = 4241 (Functional activity of BIF as determined by phosphorylation of hIR-A expressed in 293 cells) | |||
| 35840338 | 2022 | BIF | 296 | Single-chain variant of insulin has modifications:TyrB16Glu,PheB25His,ThrB27Gly,ProB28Gly,LysB29Gly,ThrB30Gly,IleA10Thr,TyrA14Asp,AsnA21Gly, single-chain variant of insulin with B-chain linked to A-chain by a short linker (Linker 1) | Interdomain linker (Linker 2) connecting the A-chain of insulin to the Fc and the Fc domain from IgG2 | Linear | L | None | Fc-fusion protein | Antidiabetes | Blood samples for glucose measurements were collected by tail bleed conducted under brief restraint. Blood glucose was measured preinjection, 1, 2, 4, 6, 8, 10, 12, 24, 48, 72, 96, 120,144, 168, 240, and 336 hours postdose | 10 nmol/kg | 104 ± 4 | Streptozotocin STZ-treated diabetic SD rats blood protease | Insulin receptor ELISA | Streptozotocin STZ-treated diabetic SD rats blood sample | In Vivo | None | None | Receptor Phosphorylation EC50, nM = 391 (Functional activity of BIF as determined by phosphorylation of hIR-B expressed in 293 cells) | |||
| 35840338 | 2022 | BIF | 296 | single-chain variant of insulin has modifications:TyrB16Glu,PheB25His,ThrB27Gly,ProB28Gly,LysB29Gly,ThrB30Gly,IleA10Thr,TyrA14Asp,AsnA21Gly, single-chain variant of insulin with B-chain linked to A-chain by a short linker (Linker 1) | interdomain linker (Linker 2) connecting the A-chain of insulin to the Fc and the Fc domain from IgG2 | Linear | L | None | Fc-fusion protein | Antidiabetes | Blood samples for glucose measurements were collected by tail bleed conducted under brief restraint. Blood glucose was measured preinjection, 1, 2, 4, 6, 8, 10, 12, 24, 48, 72, 96, 120,144, 168, 240, and 336 hours postdose | 30 nmol/kg | 120 ± 21 | Streptozotocin STZ-treated diabetic SD rats blood protease | Insulin receptor ELISA | Streptozotocin STZ-treated diabetic SD rats blood sample | In Vivo | None | None | Receptor Phosphorylation EC50, nM > 10,000 (Functional activity of BIF as determined by phosphorylation of hIGF-1R expressed in 293 cells) | |||
| 35840338 | 2022 | BIF | 296 | single-chain variant of insulin has modifications:TyrB16Glu,PheB25His,ThrB27Gly,ProB28Gly,LysB29Gly,ThrB30Gly,IleA10Thr,TyrA14Asp,AsnA21Gly, single-chain variant of insulin with B-chain linked to A-chain by a short linker (Linker 1) | interdomain linker (Linker 2) connecting the A-chain of insulin to the Fc and the Fc domain from IgG2 | Linear | L | None | Fc-fusion protein | Antidiabetes | Blood samples for glucose measurements were collected by tail bleed conducted under brief restraint. Blood glucose was measured preinjection, 1, 2, 4, 6, 8, 10, 12, 24, 48, 72, 96, 120,144, 168, 240, and 336 hours postdose | 30 nmol/kg | 120 ± 21 | Streptozotocin STZ-treated diabetic SD rats blood protease | Insulin receptor ELISA | Streptozotocin STZ-treated diabetic SD rats blood sample | In Vivo | None | None | Lipogenesis in 3T3-L1 Adipocytes, EC50 nM = 19 (Functional activity of BIF as assessed by lipogenesis and cellular proliferation) | |||
| 35840338 | 2022 | BIF | 296 | single-chain variant of insulin has modifications:TyrB16Glu,PheB25His,ThrB27Gly,ProB28Gly,LysB29Gly,ThrB30Gly,IleA10Thr,TyrA14Asp,AsnA21Gly, single-chain variant of insulin with B-chain linked to A-chain by a short linker (Linker 1) | interdomain linker (Linker 2) connecting the A-chain of insulin to the Fc and the Fc domain from IgG2 | Linear | L | None | Fc-fusion protein | Antidiabetes | Blood samples for glucose measurements were collected by tail bleed conducted under brief restraint. Blood glucose was measured preinjection, 1, 2, 4, 6, 8, 10, 12, 24, 48, 72, 96, 120,144, 168, 240, and 336 hours postdose | 30 nmol/kg | 120 ± 21 | Streptozotocin STZ-treated diabetic SD rats blood protease | Insulin receptor ELISA | Streptozotocin STZ-treated diabetic SD rats blood sample | In Vivo | None | None | Proliferation in Saos-2 Cells,EC50 nM = 134 (Functional activity of BIF as assessed by cellular proliferation) | |||
| 35840338 | 2022 | BIF | 296 | single-chain variant of insulin has modifications:TyrB16Glu,PheB25His,ThrB27Gly,ProB28Gly,LysB29Gly,ThrB30Gly,IleA10Thr,TyrA14Asp,AsnA21Gly, single-chain variant of insulin with B-chain linked to A-chain by a short linker (Linker 1) | interdomain linker (Linker 2) connecting the A-chain of insulin to the Fc and the Fc domain from IgG2 | Linear | L | None | Fc-fusion protein | Antidiabetes | Blood samples for glucose measurements were collected by tail bleed conducted under brief restraint. Blood glucose was measured preinjection, 1, 2, 4, 6, 8, 10, 12, 24, 48, 72, 96, 120,144, 168, 240, and 336 hours postdose | 30 nmol/kg | 120 ± 21 | Streptozotocin STZ-treated diabetic SD rats blood protease | Insulin receptor ELISA | Streptozotocin STZ-treated diabetic SD rats blood sample | In Vivo | None | None | Proliferation in H4IIE Cells,EC50 nM = 20 (Functional activity of BIF as assessed by cellular proliferation) | |||
| 35674880 | 2022 | Tirzepatide | 39 | Free | Free | Linear | L | C20 fatty diacid conjugation at the side chain of the Lys20, Aib = alpha-amino isobutyric acid at position 2,13 | GLP-1 analogs | Antidiabetes | Plasma concentrations of tirzepatide measured pre-dose, and at 8, 12, 24, 48, 72, 96, 168, and 336 hours post-dose | 5 mg | 124 | Human Plasma Protease | LC-MS | Human plasma with Normal hepatic function | In Vivo | None | None | N.A. | |||
| 35674880 | 2022 | Tirzepatide | 39 | Free | Free | Linear | L | C20 fatty diacid conjugation at the side chain of the Lys20, Aib = alpha-amino isobutyric acid at position 2,13 | GLP-1 analogs | Antidiabetes | Plasma concentrations of tirzepatide measured pre-dose, and at 8, 12, 24, 48, 72, 96, 168, and 336 hours post-dose | 5 mg | 131 | Human Plasma Protease | LC-MS | Human plasma with Mild hepatic impairment | In Vivo | None | None | N.A. | |||
| 35674880 | 2022 | Tirzepatide | 39 | Free | Free | Linear | L | C20 fatty diacid conjugation at the side chain of the Lys20, Aib = alpha-amino isobutyric acid at position 2,13 | GLP-1 analogs | Antidiabetes | Plasma concentrations of tirzepatide measured pre-dose, and at 8, 12, 24, 48, 72, 96, 168, and 336 hours post-dose | 5 mg | 116 | Human Plasma Protease | LC-MS | Human plasma with Moderate hepatic impairment | In Vivo | None | None | N.A. | |||
| 35674880 | 2022 | Tirzepatide | 39 | Free | Free | Linear | L | C20 fatty diacid conjugation at the side chain of the Lys20, Aib = alpha-amino isobutyric acid at position 2,13 | GLP-1 analogs | Antidiabetes | Plasma concentrations of tirzepatide measured pre-dose, and at 8, 12, 24, 48, 72, 96, 168, and 336 hours post-dose | 5 mg | 122 | Human Plasma Protease | LC-MS | Human plasma with Severe hepatic impairment | In Vivo | None | None | N.A. | |||
| 35458385 | 2022 | FL-EK1 | 162 | Flexible 35-mer linker (L35) connects the FN3 domain to the EK1 peptide at N terminus | Free | Linear | L | None | EK1 and 10th FN3 unit conjugate | Pan-cov fusion inhibitor | Serum samples were collected before (0 h) and after injection of EK1 (0.5 h, 1 h, 3 h, 7 h, and 12 h) or FL-EK1 (0.5 h, 1 h, 3 h, 7 h, 24 h, 48 h, 72 h, and 96 h) | 40 mg/kg | 30.0 ± 12.8 | Mice serum protease | Sandwich ELISA | Mice serum | In Vivo | None | None | IC50(nM) = 114.5 ± 33.4 against B.1.1.7 (Alpha), IC50(nM) = 201.2 ± 16.8 against B.1.351 (Beta), IC50(nM) = 373.1 ± 16.9 against P.1 (Gamma), IC50(nM) = 133.0 ± 16.5 against B.1.617.2 (Delta), IC50(nM) = 179.2 ± 38.3 against B.1.525 (Eta), IC50(nM) = 230.9 ± 49.3 against B.1.617.1 (Kappa), IC50(nM) = 88.5 ± 58.2 against C.37 (Lambda), IC50(nM) = 297.5 ± 188.2 against B.1.1.529 (Omicron) | |||
| 35455421 | 2022 | FLT | 163 | FN3 domain | Free | Linear | L | None | FN3 ,T1144 fusion protein | Antiviral (HIV fusion inhibitor) | Blood samples were collected from the orbital sinus at 0, 0.5, 1.5, 3, 6, 9, 12, 24, 48, 72, 96 and 120 h after injection of the inhibitors tested | 5.94 mg/kg | 27.09 ± 6.9 | Rats serum protease | Sandwich ELISA | Rats serum | In Vivo | None | None | IC50(nM)= 65.3 ± 2.6 against HIV-1 96USSN20 (X4/R5, A), IC50(nM) = 9.8 ± 0.9 against HIV-1 96USNG17 (X4, A), IC50(nM) = 6.5 ± 0.2 against HIV-1 90US_873 (R5, B), IC50(nM) = 8.8 ± 0.3 against HIV-1 BZ167 (X4, B), IC50(nM) = 12.5 ± 0.5 against HIV-1 SE364 (R5, C), IC50(nM) = 9.3 ± 0.5 against HIV-1 PBL288 (R5, C), IC50(nM) = 11.7 ± 0.8 against HIV-1 92UG001 (X4/R5, D), IC50(nM) = 6.4 ± 0.3 against HIV-1 J32228M4 (R5, D), IC50(nM) = 7.5 ± 0.3 against HIV-1 DJ263 (R5, CRF02_AG), IC50(nM) = 10.2 ± 0.6 against HIV-1 CAM1475MV (R5, CRF02_AG) (Infection on MT-4 cells) | |||
| 35046019 | 2022 | ELP(10FA)GFP | 400 | Free | GFP | Linear | L | 10 Fatty acid conjugation through pAzF (para-azidophenylalanine) | ELP-GFP conjugate | Increases Half Life | 1 week | 10 μM | 33.3 | C57Bl/6J mice blood plasma protease | GFP-specific ELISA | C57BL/6J mice blood plasma | In Vivo | None | None | KD MSA (μM) =2.76 ± 0.19, KD HSA - Human serum albumin (μM) = n.d | |||
| 35046019 | 2022 | ELP(5FA)GFP | 400 | Free | GFP | Linear | L | 5 Fatty acid conjugation through pAzF (para-azidophenylalanine) | ELP-GFP conjugate | Increases Half Life | 1 week | 10 μM | 31.7 | C57Bl/6J mice blood plasma protease | GFP-specific ELISA | C57BL/6J mice blood plasma | In Vivo | None | None | KD MSA (μM) =4.0 ± 1.6, KD HSA - Human serum albumin (μM) = 3.16 ± 0.60 | |||
| 35046019 | 2022 | ELP(10FA)GFP | 400 | Free | GFP | Linear | L | 10 Fatty acid conjugation through pAzF (para-azidophenylalanine) | ELP-GFP conjugate | Increases Half Life | 1 week | 10 μM | 27.9 | C57Bl/6J mice blood plasma protease | GFP-specific ELISA | C57BL/6J mice blood plasma | In Vivo | None | None | KD MSA (μM) = 2.22 ± 0.03, KD HSA - Human serum albumin (μM) = 1.64 ± 0.17 | |||
| N.A. | 2022 | Chem.37 (reference compound) | 33 | k=D-Lysine,Sar=N-terminal glycine, N£-octadecanoyl | Free | Linear | Mix | Aib substituitions at position 2 of semaglutide | Semaglutide Derivative | Antidiabetes | Blood samples (0.8 Ml) were taken via the second catheter at predetermined time points (0-3 weeks) | 10 nmol/kg | 78 (Terminal Half Life) | Minipigs plasma protease | LC-MS | Minipigs plasma | In Vivo | None | EP 2021080747 W | N.A. | |||
| N.A. | 2022 | Test 1 | N.A. | N.A. | N.A. | N.A. | N.A. | N.A. | GLP-1 analogs | Antidiabetes | Blood samples (0.8 Ml) were taken via the second catheter at predetermined time points (0-3 weeks) | 10 nmol/kg | 100 (Terminal Half Life) | Minipigs plasma protease | LC-MS | Minipigs plasma | In Vivo | None | EP 2021080747 W | N.A. | |||
| N.A. | 2022 | Test 2 | N.A. | N.A. | N.A. | N.A. | N.A. | N.A. | GLP-1 analogs | Antidiabetes | Blood samples (0.8 Ml) were taken via the second catheter at predetermined time points (0-3 weeks) | 10 nmol/kg | 101 (Terminal Half Life) | Minipigs plasma protease | LC-MS | Minipigs plasma | In Vivo | None | EP 2021080747 W | N.A. | |||
| N.A. | 2022 | Test 3 | N.A. | N.A. | N.A. | N.A. | N.A. | N.A. | GLP-1 analogs | Antidiabetes | Blood samples (0.8 Ml) were taken via the second catheter at predetermined time points (0-3 weeks) | 10 nmol/kg | 105 (Terminal Half Life) | Minipigs plasma protease | LC-MS | Minipigs plasma | In Vivo | None | EP 2021080747 W | N.A. | |||
| N.A. | 2022 | Test 4 | N.A. | N.A. | N.A. | N.A. | N.A. | N.A. | GLP-1 analogs | Antidiabetes | Blood samples (0.8 Ml) were taken via the second catheter at predetermined time points (0-3 weeks) | 10 nmol/kg | 109 (Terminal Half Life) | Minipigs plasma protease | LC-MS | Minipigs plasma | In Vivo | None | EP 2021080747 W | N.A. | |||
| N.A. | 2022 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | GLP-1 receptor agonist | Blood samples (0.8 Ml) were taken via the second catheter at predetermined time points (0-3 weeks) | 10 nmol/kg | 69 (Terminal Half Life) | Minipigs plasma protease | LC-MS | Minipigs plasma | In Vivo | None | EP 2021080747 W | N.A. | |||
| N.A. | 2022 | TROP2 TRACTr PC complex (PC5) | 911 | Free | Fab heavy chain linked to C terminus of ScFv light chain | Linear | L | None | Synthetic | Mediates tumor cytotoxicity and T cell activation | N.A. | 100 ug/kg | 90.16 | Cynomolgus monkeys plasma protease | ELISA | Cynomolgus monkeys plasma | In Vivo | None | US 2021/0062261 W | EC50(nM) = 60.25 (TROP binding) | |||
| N.A. | 2022 | TROP2 TRACTr PC complex (PC18) | 916 | Free | Fab heavy chain linked to C terminus of ScFv light chain | Linear | L | None | Synthetic | Mediates tumor cytotoxicity and T cell activation | N.A. | 100 μg/kg | 97.31 | Cynomolgus monkeys plasma protease | ELISA | Cynomolgus monkeys plasma | In Vivo | None | US 2021/0062261 W | IC50(pM) = 3,253 | |||
| N.A. | 2022 | TROP2 TRACTr PC complex (PC21) | 1177 | Free | Fab heavy chain linked to C terminus of ScFv light chain | Linear | L | None | Synthetic | Mediates tumor cytotoxicity and T cell activation | N.A. | 100 μg/kg | 100.73 | Cynomolgus monkeys plasma protease | ELISA | Cynomolgus monkeys plasma | In Vivo | None | US 2021/0062261 W | N.A. | |||
| N.A. | 2022 | PC-22 complex | 911 | Free | Fab heavy chain linked to C terminus of ScFv light chain | Linear | L | None | Synthetic | Mediates tumor cytotoxicity and T cell activation | N.A. | 100 μg/kg | 68.97 | Cynomolgus monkeys plasma protease | ELISA | Cynomolgus monkeys plasma | In Vivo | None | US 2021/0062261 W | N.A. | |||
| 35259149 | 2022 | Conjugate 2 | 31 | Free | Ethylene Diamine-modified chondroitin90 (CH) linked with C terminus of GLP-1C using linker C12 , (N-[λ-maleimidododecanoyloxy]-sulfosuccinimide ester (sulfo-LMDS, C12 derived from LMDS) | Linear | L | None | CH-Conjugated Glp-1C Peptide | Antidiabetes | Blood samples were collected from the tail vein at 0, 12, 24, 48, 72, 96, 120, and 144 h postadministration | 300 nmol/kg | 25.3 (T1/2 Elimination Half Life) | ICR mice plasma protease | ELISA | ICR mice plasma | In Vivo | https://pubs.acs.org/doi/10.1021/acsomega.9b00059, https://pubmed.ncbi.nlm.nih.gov/28365509/ | None | EC50 = 9.9 nM | |||
| 35259149 | 2022 | Conjugate 2 | 31 | Free | Ethylene Diamine-modified chondroitin90 (CH) linked with C terminus of GLP-1C using linker C12 , (N-[λ-maleimidododecanoyloxy]-sulfosuccinimide ester (sulfo-LMDS, C12 derived from LMDS) | Linear | L | None | CH-Conjugated Glp-1C Peptide | Antidiabetes | Blood samples were collected from the tail vein at 0, 12, 24, 48, 72, 96, 120, and 144 h postadministration | 100 nmol/kg | 30.3 (T1/2 Elimination Half Life) | ICR mice plasma protease | ELISA | ICR mice plasma | In Vivo | https://pubs.acs.org/doi/10.1021/acsomega.9b00059, https://pubmed.ncbi.nlm.nih.gov/28365509/ | None | EC50 = 9.9 nM | |||
| 35259149 | 2022 | Conjugate 3 | 31 | Free | Ethylene Diamine-modified heparosan (HPN) linked with C terminus of GLP-1C using linker C12 , (N-[λ-maleimidododecanoyloxy]-sulfosuccinimide ester (sulfo-LMDS, C12 derived from LMDS) | Linear | L | None | Hpn-Conjugated Glp-1C Peptide | Antidiabetes | Blood samples were collected from the tail vein at 0, 12, 24, 48, 72, 96, 120, and 144 h postadministration | 300 nmol/kg | 33.6 (T1/2 Elimination Half Life) | ICR mice plasma protease | ELISA | ICR mice plasma | In Vivo | https://pubs.acs.org/doi/10.1021/acsomega.9b00059, https://pubmed.ncbi.nlm.nih.gov/28365509/ | None | EC50 = 7.0 nM | |||
| 35259149 | 2022 | Conjugate 3 | 31 | Free | Ethylene Diamine-modified heparosan (HPN) linked with C terminus of GLP-1C using linker C12 , (N-[λ-maleimidododecanoyloxy]-sulfosuccinimide ester (sulfo-LMDS, C12 derived from LMDS) | Linear | L | None | Hpn-Conjugated Glp-1C Peptide | Antidiabetes | Blood samples were collected from the tail vein at 0, 12, 24, 48, 72, 96, 120, and 144 h postadministration | 100 nmol/kg | 25.8 (T1/2 Elimination Half Life) | ICR mice plasma protease | ELISA | ICR mice plasma | In Vivo | https://pubs.acs.org/doi/10.1021/acsomega.9b00059, https://pubmed.ncbi.nlm.nih.gov/28365509/ | None | EC50 = 7.0 nM | |||
| 35651477 | 2022 | LY3298176 | 39 | Free | Amidation | Linear | L | Conjugated to a C20 fatty diacid moiety via a linker connected to the lysine residue at position 20 (C20 diacid-yGlu-(AEEA)2), two non-coded amino acid residues at positions 2 and 13 (Aib, α-amino isobutyric acid) | Fatty Acid Modified Peptide | Antidiabetes | Blood samples for PK assessment of LY3298176 in the SAD part were collected at predose, 8, 24, 48, 72, 96, 120, 168, and 336 hours postdose | 0.25 mg | 116 | Human plasma protease | HRAM LC/MS | Human plasma | In Vivo | https://pubmed.ncbi.nlm.nih.gov/30473097/ | None | GIPR, EC50 nM (cAMP potency) = 0.0224 | |||
| 35651477 | 2022 | LY3298176 | 39 | Free | Amidation | Linear | L | Conjugated to a C20 fatty diacid moiety via a linker connected to the lysine residue at position 20 (C20 diacid-yGlu-(AEEA)2), two non-coded amino acid residues at positions 2 and 13 (Aib, α-amino isobutyric acid) | Fatty Acid Modified Peptide | Antidiabetes | Blood samples for PK assessment of LY3298176 in the SAD part were collected at predose, 8, 24, 48, 72, 96, 120, 168, and 336 hours postdose | 0.5 mg | 124 | Human plasma protease | HRAM LC/MS | Human plasma | In Vivo | https://pubmed.ncbi.nlm.nih.gov/30473097/ | None | GIPR, EC50 nM (cAMP potency) = 0.0224 | |||
| 35651477 | 2022 | LY3298176 | 39 | Free | Amidation | Linear | L | Conjugated to a C20 fatty diacid moiety via a linker connected to the lysine residue at position 20 (C20 diacid-yGlu-(AEEA)2), two non-coded amino acid residues at positions 2 and 13 (Aib, α-amino isobutyric acid) | Fatty Acid Modified Peptide | Antidiabetes | Blood samples for PK assessment of LY3298176 in the SAD part were collected at predose, 8, 24, 48, 72, 96, 120, 168, and 336 hours postdose | 1 mg | 106 | Human plasma protease | HRAM LC/MS | Human plasma | In Vivo | https://pubmed.ncbi.nlm.nih.gov/30473097/ | None | GIPR, EC50 nM (cAMP potency) = 0.0224 | |||
| 35651477 | 2022 | LY3298176 | 39 | Free | Amidation | Linear | L | Conjugated to a C20 fatty diacid moiety via a linker connected to the lysine residue at position 20 (C20 diacid-yGlu-(AEEA)2), two non-coded amino acid residues at positions 2 and 13 (Aib, α-amino isobutyric acid) | Fatty Acid Modified Peptide | Antidiabetes | Blood samples for PK assessment of LY3298176 in the SAD part were collected at predose, 8, 24, 48, 72, 96, 120, 168, and 336 hours postdose | 2.5 mg | 120 | Human plasma protease | HRAM LC/MS | Human plasma | In Vivo | https://pubmed.ncbi.nlm.nih.gov/30473097/ | None | GIPR, EC50 nM (cAMP potency) = 0.0224 | |||
| 35651477 | 2022 | LY3298176 | 39 | Free | Amidation | Linear | L | Conjugated to a C20 fatty diacid moiety via a linker connected to the lysine residue at position 20 (C20 diacid-yGlu-(AEEA)2), two non-coded amino acid residues at positions 2 and 13 (Aib, α-amino isobutyric acid) | Fatty Acid Modified Peptide | Antidiabetes | Blood samples for PK assessment of LY3298176 in the SAD part were collected at predose, 8, 24, 48, 72, 96, 120, 168, and 336 hours postdose | 5 mg | 123 | Human plasma protease | HRAM LC/MS | Human plasma | In Vivo | https://pubmed.ncbi.nlm.nih.gov/30473097/ | None | GIPR, EC50 nM (cAMP potency) = 0.0224 | |||
| 35651477 | 2022 | LY3298176 | 39 | Free | Amidation | Linear | L | Conjugated to a C20 fatty diacid moiety via a linker connected to the lysine residue at position 20 (C20 diacid-yGlu-(AEEA)2), two non-coded amino acid residues at positions 2 and 13 (Aib, α-amino isobutyric acid) | Fatty Acid Modified Peptide | Antidiabetes | Blood samples for PK assessment of LY3298176 in the SAD part were collected at predose, 8, 24, 48, 72, 96, 120, 168, and 336 hours postdose | 8 mg | 111 | Human plasma protease | HRAM LC/MS | Human plasma | In Vivo | https://pubmed.ncbi.nlm.nih.gov/30473097/ | None | GIPR, EC50 nM (cAMP potency) = 0.0224 | |||
| 35807558 | 2022 | Tirzepatide | 39 | Free | Amidation | Linear | L | C20 fatty diacid moiety at Lys20 | Synthetic | Insulinotrophic | N.A. | 5 mg | 127 | Human plasma protease | N.A. | Human plasma With Multiple Dose (Participants Received 5‐Mg Tirzepatide Weeks 1‐8)(Japanese Participant With Type 2 Diabetes) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/34647404/, https://pubmed.ncbi.nlm.nih.gov/30399314/ | None | N.A. | |||
| 35807558 | 2022 | Tirzepatide | 39 | Free | Amidation | Linear | L | C20 fatty diacid moiety at Lys20 | Synthetic | Insulinotrophic | N.A. | 10 mg | 135 | Human plasma protease | N.A. | Human plasma With Multiple Dose (Participants Received 2.5‐Mg Tirzepatide, Weeks 1‐2; 5 Mg, Weeks 3‐4; 10 Mg, Weeks 5‐8) (Japanese Participant With Type 2 Diabetes) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/34647404/, https://pubmed.ncbi.nlm.nih.gov/30399314/ | None | N.A. | |||
| 35807558 | 2022 | Tirzepatide | 39 | Free | Amidation | Linear | L | C20 fatty diacid moiety at Lys20 | Synthetic | Insulinotrophic | N.A. | 15 mg | 121 | Human plasma protease | N.A. | Human plasma With Multiple Dose(Participants Received 5‐Mg Tirzepatide, Weeks 1‐2; 10 Mg, Weeks 3‐6; 15 Mg, Weeks 7‐8) (Japanese Participant With Type 2 Diabetes) | In Vivo | https://pubmed.ncbi.nlm.nih.gov/34647404/, https://pubmed.ncbi.nlm.nih.gov/30399314/ | None | N.A. | |||
| 34707178 | 2021 | PYY3-36 analogues 20 | 34 | Free | Amidation | Linear | L | Fatty acid conjugation at position 22 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 36 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | EC50(nM) = 4 for Y2 receptor | |||
| 34707178 | 2021 | PYY3-36 analogues 27 | 34 | Free | Amidation | Linear | L | Fatty acid conjugation at position 29 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 39 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | EC50(nM) = 32 for Y2 receptor | |||
| 34707178 | 2021 | PYY3-36 analogues 28 | 34 | Free | Amidation | Linear | L | Fatty acid conjugation at position 30 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 76 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | EC50(nM) = 500 for Y2 receptor | |||
| 34707178 | 2021 | PYY3-36 analogues 31 | 34 | Free | Amidation | Linear | L | Fatty acid conjugation at position 33 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 56 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | EC50(nM) = 50 for Y2 receptor | |||
| 34707178 | 2021 | PYY3-36 analogues 33 | 34 | Free | Amidation | Linear | L | Fatty acid conjugation at position 35 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 67 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | N.A. | |||
| 34707178 | 2021 | PYY3-36 analogues 35 | 34 | Free | Amidation | Linear | L | Fatty acid conjugation at position 30 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 28 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | N.A. | |||
| 34707178 | 2021 | PYY3-36 analogues 36 | 34 | Free | Amidation | Linear | L | Fatty acid conjugation at position 30 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 99 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | N.A. | |||
| 34707178 | 2021 | PYY3-36 analogues 41 | 34 | Free | Amidation | Linear | L | Fatty acid conjugation at position 30 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 97 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | N.A. | |||
| 34707178 | 2021 | PYY3-36 analogues 42 | 34 | Free | Amidation | Linear | L | Fatty acid conjugation at position 30 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 75 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | N.A. | |||
| 34707178 | 2021 | PYY3-36 analogues 43 | 34 | Free | Amidation | Linear | L | Fatty acid conjugation at position 30 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 78 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | N.A. | |||
| 34707178 | 2021 | PYY3-36 analogues 45 | 34 | Free | Amidation | Linear | L | Fatty acid conjugation at position 4, MeArg4 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 83 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | N.A. | |||
| 34707178 | 2021 | PYY3-36 analogues 46 | 35 | Free | Amidation | Linear | L | Fatty acid conjugation at position 30 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 84 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | N.A. | |||
| 34707178 | 2021 | PYY3-36 analogues 47 | 35 | Free | Amidation | Linear | L | Fatty acid conjugation at position 30 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 62 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | N.A. | |||
| 34707178 | 2021 | PYY3-36 analogues 48 | 35 | Free | Amidation | Linear | L | Fatty acid conjugation at position 30 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 104 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | N.A. | |||
| 34707178 | 2021 | PYY3-36 analogues 49 | 35 | Free | Amidation | Linear | L | Fatty acid conjugation at position 30, Acetylation at Asn28 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 113 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | N.A. | |||
| 34707178 | 2021 | PYY3-36 analogues 51 | 36 | Free | Amidation | Linear | L | Fatty acid conjugation at position 30, Acetylation at Asn28 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 114 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | N.A. | |||
| 34707178 | 2021 | PYY3-36 analogues 52 | 36 | Free | Amidation | Linear | L | Fatty acid conjugation at position 30, Acetylation at Asn28 | Derived from PYY | Antiobesity | N.A. | 15 nmol/kg | 79 | Male göttingen minipigs plasma protease | LC-MS | Male göttingen minipigs plasma | In Vivo | None | None | EC50(nM) = 30 for Y2 receptor | |||
| 34450223 | 2021 | GLP-2DARPin | 31 | Genetic fusion of modified GLP-1 to the N-terminal of DARPins through a flexible linke (GGGGS)3 further DARPin linked with another DARPin using PT-linker | Free | Linear | L | FITC labeled | GLP-1 analogs | Antidiabetes | At 0.5, 2, 4, 7, 10, 24, 36, 48 and 72 h after injection, 20 μL of blood was collected | 2 mg/mL | 52.3 ± 4.6 | Mice plasma protease | Fluorescence assay | Mice plasma | In Vivo | None | None | Glucose-lowering effect of GLP-DARPin was more potent than that of GLP-2DARPin, EC50 of GLP-2DARPin was 0.51 ± 0.04 nM | |||
| 34254101 | 2021 | Glycylglycine model dipeptide | 2 | Free | Free | Linear | L | None | Synthetic | N.A. | 60 °C and pD 7.4 | Equimolar amounts of Hf-NU-1000 and GG | 231 | N.A. | 1H-NMR | Equimolar amounts of Hf-NU-1000 (Metal-organic Framework)(Hf6O8-based NU-1000) and GG | In Vitro | None | None | A glycylglycine model dipeptide was hydrolysed with a rate constant of kobs = 8.33 × 10−7 s−1 | |||
| 34206631 | 2021 | KK 103 | 6 | N terminal of Tyr linked with NH bond with R1 = Structure given in paper | Free | Linear | L | None | Synthetic | Analgesic | Aliquot (95 µL) was taken at 0, 5, 15, 60, and 300 min | 315 µmol/L | 37 | Mice plasma protease | UPLC | Mice dipotassium ethylenediaminetetraacetic acid containing pooled plasma | In Vitro | None | None | N.A. | |||
| 34064291 | 2021 | 111In-DOTA-EB-cRGDfK | 5 | Radiolabelled with 111ln, DOTA, EvansBlue dye | Free | Cyclic | L | None | Synthetic | For Spect imaging and potential theranostic | Blood samples (10 μL) were collected by heart puncture under 2% isoflurane anesthesia at 0.083, 0.5, 2, 4, 24, 48, 72, 96, and 168 h | 1.85 MBq | 77.3 (Terminal Half Life) | U-87 mg tumor bearing mice plasma protease | Radioactivity assay | U-87 mg tumor-bearing mice plasma | In Vivo | None | None | IC50(nM) =71.7 | |||
| 33969456 | 2021 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | Antidiabetes | Blood samples for PK assessment were obtained during the first 9 days of dosing (7–45 samples per subject) and following the last dose on day 10 (16–38 samples per subject) | N.A. | 158 | Human plasma protease | LC-MS | Human plasma (Healthy subjects) | In Vivo | https://pmc.ncbi.nlm.nih.gov/articles/PMC8736331/ | None | N.A. | |||
| 33969456 | 2021 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | Antidiabetes | Blood samples for PK assessment were obtained during the first 9 days of dosing (7–45 samples per subject) and following the last dose on day 10 (16–38 samples per subject) | N.A. | 146 | Human plasma protease | LC-MS | Human plasma (Subjects with T2D) | In Vivo | https://pmc.ncbi.nlm.nih.gov/articles/PMC8736331/ | None | N.A. | |||
| 33894838 | 2021 | Cagrilintide | 37 | Free | Amidation | Cyclic (Cys-Cys Disulfide Bond) | Mix | LPPTNVGSNTP all D-amino acids, Lipidation on Lys1 | amylin analogue | Antiobesity | Blood samples for pharmacokinetic testing were collected before dosing at baseline (week 0) and at weekly visits, and after the last dose (week 19) at 4, 8, 12, 24, 48, 72, 96, 168, 336, 504, 672, 840, and 1008 h after dosing | 0·16 − 4·5 mg | 159 – 195 | Human plasma protease | N.A. | Human plasma | In Vivo | pubchem CID: 171397054 | None | N.A. | |||
| 33894838 | 2021 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | Antidiabetes | Blood samples for pharmacokinetic testing were collected before dosing at baseline (week 0) and at weekly visits, and after the last dose (week 19) at 4, 8, 12, 24, 48, 72, 96, 168, 336, 504, 672, 840, and 1008 h after dosing | 2·4 mg | 145 – 165 | Human plasma protease | N.A. | Human plasma | In Vivo | None | None | N.A. | |||
| 33822591 | 2021 | PEG−DNP-Lys conjugates 6C | 1 | DNP | PEG20 KDa, MeO | Linear | L | GDM linker with a two-carbon spacer between the β-carbon and the triazole, Mod = NC−, X = Structure given in paper (n=0) | Synthetic | Increases Half Life | pH 7.4 | N.A. | 87 (b-Elimination Half-Life) | N.A. | N.A. | N.A. | In Vitro | None | None | N.A. | |||
| 33822591 | 2021 | PEG−DNP-Lys conjugates 6C | 1 | DNP | PEG20 KDa, MeO | Linear | L | GDM linker with a two-carbon spacer between the β-carbon and the triazole, Mod = NC−, X = Structure given in paper (n=0) | Synthetic | Increases Half Life | pH 7.4 | N.A. | 87 (b-Elimination Half-Life) | N.A. | N.A. | N.A. | In Vitro | None | None | N.A. | |||
| 33822591 | 2021 | PEG−DNP-Lys conjugates 6C | 1 | DNP | PEG20 KDa, MeO | Linear | L | GDM linker with a two-carbon spacer between the β-carbon and the triazole, Mod = NC−, X = Structure given in paper (n=0) | Synthetic | Increases Half Life | pH 7.4 | N.A. | 1030 (b-Elimination Half-Life) | N.A. | N.A. | N.A. | In Vitro | None | None | N.A. | |||
| 33822591 | 2021 | PEG−DNP-Lys conjugates 7 | 1 | DNP | PEG20 KDa, MeO | Linear | L | GDM linker with a three-carbon spacer between the β-carbon and the triazole, Mod = PhSO2−, X = Structure given in paper (n=1) | Synthetic | Increases Half Life | pH 7.4 | N.A. | 256 (b-Elimination Half-Life) | N.A. | N.A. | N.A. | In Vitro | None | None | N.A. | |||
| 33822591 | 2021 | PEG−DNP-Lys conjugates 7 | 1 | DNP | PEG20 KDa, MeO | Linear | L | GDM linker with a three-carbon spacer between the β-carbon and the triazole, Mod = PhSO2−, X = Structure given in paper (n=1) | Synthetic | Increases Half Life | pH 7.4 | N.A. | 724 (b-Elimination Half-Life) | N.A. | N.A. | N.A. | In Vitro | None | None | N.A. | |||
| 33822591 | 2021 | PEG−DNP-Lys conjugates 7 | 1 | DNP | PEG20 KDa, MeO | Linear | L | GDM linker with a three-carbon spacer between the β-carbon and the triazole, Mod = PhSO2−, X = Structure given in paper (n=1) | Synthetic | Increases Half Life | pH 7.4 | N.A. | 2490 (b-Elimination Half-Life) | N.A. | N.A. | N.A. | In Vitro | None | None | N.A. | |||
| 33822591 | 2021 | PEG−DNP-Lys conjugates 8 | 1 | DNP | PEG20 KDa, MeO | Linear | L | GDM linker with a four-carbon spacer between the β-carbon and the triazole, Mod = MeSO2−, X = Structure given in paper (n=2) | Synthetic | Increases Half Life | pH 7.4 | N.A. | 1570 (b-Elimination Half-Life) | N.A. | N.A. | N.A. | In Vitro | None | None | N.A. | |||
| 33822591 | 2021 | PEG−DNP-Lys conjugates 8 | 1 | DNP | PEG20 KDa, MeO | Linear | L | GDM linker with a four-carbon spacer between the β-carbon and the triazole, Mod = MeSO2−, X = Structure given in paper (n=2) | Synthetic | Increases Half Life | pH 7.4 | N.A. | 5310 (b-Elimination Half-Life) | N.A. | N.A. | N.A. | In Vitro | None | None | N.A. | |||
| 33706686 | 2021 | TB01-3 | 39 | Free | Free | Linear | L | None | Synthetic | Antidiabetes | 250 ul blood samples were collected via jugular vein cannula at these time points: pre-dose, 0.0833, 0.25, 0.5, 1, 2, 4, 8, 24, 48, 72, 96, 168, 240 and 336 hours post dose. | 10 mg/kg | ~1 | Rats plasma protease | ELISA | Rats plasma | In Vivo | None | None | TB59-2 binds specifically to the GLP-1 R with an EC50 of 15.5 nM, TB-59-2 is a potent agonist in the cAMP assay with a similar EC50 as the GLP-1 7–36 peptide, TB59-2 can also induce the β-arrestin recruitment in GLP-1 R expression cells | |||
| 33706686 | 2021 | TB59-2 | 30 | GLP-1 7–36 peptide is linked to the light chain N-terminal of the TB01-2 antibody via a (G4S)x3 linker | Free | Linear | L | None | Synthetic | Antidiabetes | 250 ul blood samples were collected via jugular vein cannula at these time points: pre-dose, 0.0833, 0.25, 0.5, 1, 2, 4, 8, 24, 48, 72, 96, 168, 240 and 336 hours post dose. | 10 mg/kg | >2 | Rats plasma protease | ELISA | Rats plasma | In Vivo | None | None | TB59-2 binds specifically to the GLP-1 R with an EC50 of 15.5 nM, TB-59-2 is a potent agonist in the cAMP assay with a similar EC50 as the GLP-1 7–36 peptide, TB59-2 can also induce the β-arrestin recruitment in GLP-1 R expression cells | |||
| 33674401 | 2021 | 177Lu-DOTA-LM3 | 9 | DOTA | Amidation | Cyclic(C-C NC terminal bond) | Mix | DOTA-LM3 conjugation, Cbm = Carbamoyl, 177Lu labeling, pCl-Phe = P-Chloro Phenyalanine | SST analog | Treating Metastatic Neuroendocrine Neoplasms (Nens) | N.A. | 7 ± 1 GBq | 76 | Whole body | Dosimetry | whole body | In Vivo | None | None | Partial Remission: 17 patients (36.2%), Stable Disease: 23 patients (48.9%), Progressive Disease: 7 patients (14.9%) (The efficacy of the peptide 177Lu-DOTA-LM3 for peptide receptor radionuclide therapy (PRRT) in patients with metastatic neuroendocrine neoplasms ) | |||
| 33674401 | 2021 | 177Lu-DOTA-LM3 | 9 | DOTA | Amidation | Cyclic | Mix | DOTA-LM3 conjugation, Cbm = Carbamoyl, 177Lu labeling, pCl-Phe = P-Chloro Phenyalanine | SST analog | Treating Metastatic Neuroendocrine Neoplasms (Nens) | N.A. | 7 ± 1 GBq | 92 | Human kidney homogenate protease | Dosimetry | Human kidney homogenate | In Vivo | None | None | Partial Remission: 17 patients (36.2%), Stable Disease: 23 patients (48.9%), Progressive Disease: 7 patients (14.9%) (The efficacy of the peptide 177Lu-DOTA-LM3 for peptide receptor radionuclide therapy (PRRT) in patients with metastatic neuroendocrine neoplasms ) | |||
| 33674401 | 2021 | 177Lu-DOTA-LM3 | 9 | DOTA | Amidation | Cyclic | Mix | DOTA-LM3 conjugation, Cbm = Carbamoyl, 177Lu labeling, pCl-Phe = P-Chloro Phenyalanine | SST analog | Treating Metastatic Neuroendocrine Neoplasms (Nens) | N.A. | 7 ± 1 GBq | 97 | Human spleen | Dosimetry | Human spleen | In Vivo | None | None | Partial Remission: 17 patients (36.2%), Stable Disease: 23 patients (48.9%), Progressive Disease: 7 patients (14.9%) (The efficacy of the peptide 177Lu-DOTA-LM3 for peptide receptor radionuclide therapy (PRRT) in patients with metastatic neuroendocrine neoplasms ) | |||
| 33674401 | 2021 | 177Lu-DOTA-LM3 | 9 | DOTA | Amidation | Cyclic | Mix | DOTA-LM3 conjugation, Cbm = Carbamoyl, 177Lu labeling, pCl-Phe = P-Chloro Phenyalanine | SST analog | Treating Metastatic Neuroendocrine Neoplasms (Nens) | N.A. | 7 ± 1 GBq | 111 | Human metastases | Dosimetry | Human metastases | In Vivo | None | None | Partial Remission: 17 patients (36.2%), Stable Disease: 23 patients (48.9%), Progressive Disease: 7 patients (14.9%) (The efficacy of the peptide 177Lu-DOTA-LM3 for peptide receptor radionuclide therapy (PRRT) in patients with metastatic neuroendocrine neoplasms ) | |||
| 33650155 | 2021 | 3XFLAG-hDASPO_341 | 365 | 3XFLAG labelling | Free | Linear | L | None | Found in the hippocampus of female patients affected by Alzheimer's disease | Degradation Of D-Aspartate ( D-Asp) | 10 hours | 2 μg | ≈ 100 | U87 cells lysate protease | Western blotting | U87 cells lysate with cycloheximide (CHX) | In Vivo | None | None | N.A. | |||
| 33650155 | 2021 | 3XFLAG-hDASPO_369 | 393 | 3XFLAG labelling | Free | Linear | L | None | Found in the hippocampus of female patients affected by Alzheimer's disease | Degradation Of D-Aspartate ( D-Asp) | 10 hours | 2 μg | ≈ 100 | U87 cells lysate protease | Western blotting | U87 cells lysate with cycloheximide (CHX) | In Vivo | None | None | N.A. | |||
| 33049303 | 2021 | GLP-GA3-GS-L3 | 94 | Free | Free | Linear | L | GLP-1 linked with GA3 through L3 linker, FITC labeled | Synthetic | Antidiabetes | 8 h at 4 ◦C | 50 μg | 36.3 ± 7.8 | Mice plasma protease | Fluorescence assay | Mice plasma | In Vivo | None | None | Based on the ELISA method, we also found that the fusion proteins containing GA3, ABD035 and ABDCon showed no significant difference in apparent affinity for HSA (P > 0.50) | |||
| 33049303 | 2021 | GLPABD035-GS-L3 | 93 | Free | Free | Linear | L | GLP-1 linked with ABD035 through L3 linker, amino acid subsituitions with F,R,K,E,K,L,H, FITC labeled | Synthetic | Antidiabetes | 8 h at 4 ◦C | 50 μg | 31.3 ± 1.0 | Mice plasma protease | Fluorescence assay | Mice plasma | In Vivo | None | None | Based on the ELISA method, we also found that the fusion proteins containing GA3, ABD035 and ABDCon showed no significant difference in apparent affinity for HSA (P > 0.50) | |||
| 33049303 | 2021 | GLP-ABDCon-GS-L3 | 93 | Free | Free | Linear | L | GLP-1 linked with ABDCon through L3 linker, amino acid subsituitions with K,E,K,I,E,K,I,T,F,D,K,N,K,K, FITC labeled | Synthetic | Antidiabetes | 8 h at 4 ◦C | 50 μg | 38.3 ± 2.7 | Mice plasma protease | Fluorescence assay | Mice plasma | In Vivo | None | None | Based on the ELISA method, we also found that the fusion proteins containing GA3, ABD035 and ABDCon showed no significant difference in apparent affinity for HSA (P > 0.50) | |||
| 32078672 | 2020 | rFVIIIFc-VWF-XTEN (construct 4) (BIVV001) | 3,611 | Free | Free | Linear | L | Three amino acid residues (GAP) from the FVIII/XTEN junction and 9 amino acids (PPVLKRHQA) from the FVIII B-domain linker were removed, LVPR thrombin site located between DʹD3 and Fc on constructs 1 and 2 was replaced with an FVIII acidic region 2 (a2) thrombin site | Synthetic | Role in clotting | N.A. | 25 IU/kg | 31 | HemA mice plasma protease | Chromogenic activity assays | HemA mice plasma | In Vivo | PDB id : 5K8D | None | ED50 values for BIVV001 (7.5 IU/kg) and rFVIII (7.9 IU/kg) were similar | |||
| 32078672 | 2020 | rFVIIIFc-VWF-XTEN (construct 4) (BIVV001) | 3,611 | Free | Free | Linear | L | Three amino acid residues (GAP) from the FVIII/XTEN junction and 9 amino acids (PPVLKRHQA) from the FVIII B-domain linker were removed, LVPR thrombin site located between DʹD3 and Fc on constructs 1 and 2 was replaced with an FVIII acidic region 2 (a2) thrombin site | Synthetic | Role in clotting | N.A. | 50 IU/kg | 30 | HemA mice plasma protease | Chromogenic activity assays | HemA mice plasma | In Vivo | PDB id : 5K8D | None | ED50 values for BIVV001 (7.5 IU/kg) and rFVIII (7.9 IU/kg) were similar | |||
| 32078672 | 2020 | rFVIIIFc-VWF-XTEN (construct 4) (BIVV001) | 3,611 | Free | Free | Linear | L | Three amino acid residues (GAP) from the FVIII/XTEN junction and 9 amino acids (PPVLKRHQA) from the FVIII B-domain linker were removed, LVPR thrombin site located between DʹD3 and Fc on constructs 1 and 2 was replaced with an FVIII acidic region 2 (a2) thrombin site | Synthetic | Role in clotting | N.A. | 100 IU/kg | 25 | HemA mice plasma protease | Chromogenic activity assays | HemA mice plasma | In Vivo | PDB id : 5K8D | None | ED50 values for BIVV001 (7.5 IU/kg) and rFVIII (7.9 IU/kg) were similar | |||
| 32078672 | 2020 | rFVIIIFc-VWF-XTEN (construct 4) (BIVV001) | 3,611 | Free | Free | Linear | L | Three amino acid residues (GAP) from the FVIII/XTEN junction and 9 amino acids (PPVLKRHQA) from the FVIII B-domain linker were removed, LVPR thrombin site located between DʹD3 and Fc on constructs 1 and 2 was replaced with an FVIII acidic region 2 (a2) thrombin site | Synthetic | Role in clotting | N.A. | 100 IU/kg | 32.7 | Cynomolgus monkeys plasma protease | Chromogenic activity assays | Cynomolgus monkeys plasma | In Vivo | PDB id : 5K8D | None | ED50 values for BIVV001 (7.5 IU/kg) and rFVIII (7.9 IU/kg) were similar | |||
| 32078672 | 2020 | rFVIIIFc-VWF-XTEN (construct 4) (BIVV001) | 3,611 | Free | Free | Linear | L | Three amino acid residues (GAP) from the FVIII/XTEN junction and 9 amino acids (PPVLKRHQA) from the FVIII B-domain linker were removed, LVPR thrombin site located between DʹD3 and Fc on constructs 1 and 2 was replaced with an FVIII acidic region 2 (a2) thrombin site | Synthetic | Role in clotting | N.A. | 300 IU/kg | 33.6 | Cynomolgus monkeys plasma protease | Chromogenic activity assays | Cynomolgus monkeys plasma | In Vivo | PDB id : 5K8D, https://pmc.ncbi.nlm.nih.gov/articles/instance/7180082/bin/bloodBLD2019001292-suppl1.pdf | None | ED50 values for BIVV001 (7.5 IU/kg) and rFVIII (7.9 IU/kg) were similar | |||
| 32078672 | 2020 | rFVIIIFc-VWF-XTEN (construct 4) (BIVV001) | 3,611 | Free | Free | Linear | L | Three amino acid residues (GAP) from the FVIII/XTEN junction and 9 amino acids (PPVLKRHQA) from the FVIII B-domain linker were removed, LVPR thrombin site located between DʹD3 and Fc on constructs 1 and 2 was replaced with an FVIII acidic region 2 (a2) thrombin site | Synthetic | Role In Clotting | N.A. | 100 IU/kg | 29.3 | Cynomolgus monkeys plasma protease | ELISA | Cynomolgus monkeys plasma | In Vivo | PDB id : 5K8D, https://pmc.ncbi.nlm.nih.gov/articles/instance/7180082/bin/bloodBLD2019001292-suppl1.pdf | None | ED50 values for BIVV001 (7.5 IU/kg) and rFVIII (7.9 IU/kg) were similar | |||
| 32078672 | 2020 | rFVIIIFc-VWF-XTEN (construct 4) (BIVV001) | 3,611 | Free | Free | Linear | L | Three amino acid residues (GAP) from the FVIII/XTEN junction and 9 amino acids (PPVLKRHQA) from the FVIII B-domain linker were removed, LVPR thrombin site located between DʹD3 and Fc on constructs 1 and 2 was replaced with an FVIII acidic region 2 (a2) thrombin site | Synthetic | Role In Clotting | N.A. | 300 IU/kg | 34 | Cynomolgus monkeys plasma protease | ELISA | Cynomolgus monkeys plasma | In Vivo | PDB id : 5K8D, https://pmc.ncbi.nlm.nih.gov/articles/instance/7180082/bin/bloodBLD2019001292-suppl1.pdf | None | ED50 values for BIVV001 (7.5 IU/kg) and rFVIII (7.9 IU/kg) were similar | |||
| 32078672 | 2020 | rFVIIIFc-VWF-XTEN (construct 4) (BIVV001) | 3,611 | Free | Free | Linear | L | Three amino acid residues (GAP) from the FVIII/XTEN junction and 9 amino acids (PPVLKRHQA) from the FVIII B-domain linker were removed, LVPR thrombin site located between DʹD3 and Fc on constructs 1 and 2 was replaced with an FVIII acidic region 2 (a2) thrombin site | Synthetic | Role In Clotting | N.A. | 200 IU/kg | 31.8 | HemA mice plasma protease | chromogenic activity assays | HemA mice plasma | In Vivo | PDB id : 5K8D, https://pmc.ncbi.nlm.nih.gov/articles/instance/7180082/bin/bloodBLD2019001292-suppl1.pdf | None | ED50 values for BIVV001 (7.5 IU/kg) and rFVIII (7.9 IU/kg) were similar | |||
| 32078672 | 2020 | rFVIIIFc-VWF-XTEN (construct 4) (BIVV001) | 3,611 | Free | Free | Linear | L | Three amino acid residues (GAP) from the FVIII/XTEN junction and 9 amino acids (PPVLKRHQA) from the FVIII B-domain linker were removed, LVPR thrombin site located between DʹD3 and Fc on constructs 1 and 2 was replaced with an FVIII acidic region 2 (a2) thrombin site | Synthetic | Role In Clotting | N.A. | 200 IU/kg | 29.9 | VWF Het mice plasma protease | chromogenic activity assays | VWF Het mice plasma | In Vivo | PDB id : 5K8D, https://pmc.ncbi.nlm.nih.gov/articles/instance/7180082/bin/bloodBLD2019001292-suppl1.pdf | None | ED50 values for BIVV001 (7.5 IU/kg) and rFVIII (7.9 IU/kg) were similar | |||
| 32078672 | 2020 | rFVIIIFc-VWF-XTEN (construct 4) (BIVV001) | 3,611 | Free | Free | Linear | L | Three amino acid residues (GAP) from the FVIII/XTEN junction and 9 amino acids (PPVLKRHQA) from the FVIII B-domain linker were removed, LVPR thrombin site located between DʹD3 and Fc on constructs 1 and 2 was replaced with an FVIII acidic region 2 (a2) thrombin site | Synthetic | Role In Clotting | N.A. | 200 IU/kg | 26.9 | DKO mice plasma protease | chromogenic activity assays | DKO mice plasma | In Vivo | PDB id : 5K8D, https://pmc.ncbi.nlm.nih.gov/articles/instance/7180082/bin/bloodBLD2019001292-suppl1.pdf | None | ED50 values for BIVV001 (7.5 IU/kg) and rFVIII (7.9 IU/kg) were similar | |||
| 33336763 | 2020 | LM06 | 33 | Free | Free | Linear | L | None | OXM analogs | Antidiabetes | The serum sample of SD rats and monkeys were collected at the time points of 0, 4, 8, 12, 24, 36, 48, 72, 96, 120, 144 and 168 h from the tails of SD rats and right fore of monkeys, respectively | 50 nmol/kg | 53.19 ± 1.42 | SD rats serum protease | LC-MS/MS | SD rats serum | In Vivo | None | None | EC50 (nM) = 0.352 (Receptor activation of LM peptides for GLP-1R) | |||
| 33336763 | 2020 | LM06 | 33 | Free | Free | Linear | L | None | OXM analogs | Antidiabetes | The serum sample of SD rats and monkeys were collected at the time points of 0, 4, 8, 12, 24, 36, 48, 72, 96, 120, 144 and 168 h from the tails of SD rats and right fore of monkeys, respectively | 100 nmol/kg | 58.37 ± 4.51 | SD rats serum protease | LC-MS/MS | SD rats serum | In Vivo | None | None | EC50 (nM) = 0.352 (Receptor activation of LM peptides for GLP-1R) | |||
| 33336763 | 2020 | LM06 | 33 | Free | Free | Linear | L | None | OXM analogs | Antidiabetes | The serum sample of SD rats and monkeys were collected at the time points of 0, 4, 8, 12, 24, 36, 48, 72, 96, 120, 144 and 168 h from the tails of SD rats and right fore of monkeys, respectively | 200 nmol/kg | 73.68 ± 6.52 | SD rats serum protease | LC-MS/MS | SD rats serum | In Vivo | None | None | EC50 (nM) = 0.352 (Receptor activation of LM peptides for GLP-1R) | |||
| 33336763 | 2020 | LM06 | 33 | Free | Free | Linear | L | None | OXM analogs | Antidiabetes | The serum sample of SD rats and monkeys were collected at the time points of 0, 4, 8, 12, 24, 36, 48, 72, 96, 120, 144 and 168 h from the tails of SD rats and right fore of monkeys, respectively | 50 nmol/kg | 56.40 ± 2.71 | Cynomolgus monkeys serum protease | LC-MS/MS | Cynomolgus monkeys serum | In Vivo | None | None | EC50 (nM) = 0.352 (Receptor activation of LM peptides for GLP-1R) | |||
| 33336763 | 2020 | LM06 | 33 | Free | Free | Linear | L | None | OXM analogs | Antidiabetes | The serum sample of SD rats and monkeys were collected at the time points of 0, 4, 8, 12, 24, 36, 48, 72, 96, 120, 144 and 168 h from the tails of SD rats and right fore of monkeys, respectively | 100 nmol/kg | 63.15 ± 4.93 | Cynomolgus monkeys serum protease | LC-MS/MS | Cynomolgus monkeys serum | In Vivo | None | None | EC50 (nM) = 0.352 (Receptor activation of LM peptides for GLP-1R) | |||
| 33336763 | 2020 | LM06 | 33 | Free | Free | Linear | L | None | OXM analogs | Antidiabetes | The serum sample of SD rats and monkeys were collected at the time points of 0, 4, 8, 12, 24, 36, 48, 72, 96, 120, 144 and 168 h from the tails of SD rats and right fore of monkeys, respectively | 200 nmol/kg | 114.91 ±7.32 | Cynomolgus monkeys serum protease | LC-MS/MS | Cynomolgus monkeys serum | In Vivo | None | None | EC50 (nM) = 0.352 (Receptor activation of LM peptides for GLP-1R) | |||
| 32841660 | 2020 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1R agonist | Attenuates renal fibrosis | N.A. | 90 nmol/kg | 64.74 ± 3.06 | SD rats serum protease | N.A. | SD rats serum | In Vivo | None | None | EC50 (nM) = 0.11 (In vitro receptor activation profiles of GLP-1 peptides for GLP-1R) | |||
| 32841660 | 2020 | XFL6 | 43 | Free | Free | Linear | L | Modifcation of lysine site at position at 16 with C16 fatty acid | GLP-1/GIP/Gcg receptor triagonist | Antidiabetes, Antiobesity | N.A. | 10 nmol/kg | 41.35 ± 1.42 | SD rats serum protease | N.A. | SD rats serum | In Vivo | None | None | EC50 (nM) = 0.12 (In vitro receptor activation profiles of XFL peptides for GLP-1R) | |||
| 32841660 | 2020 | XFL6 | 43 | Free | Free | Linear | L | Modifcation of lysine site at position at 16 with C16 fatty acid | GLP-1/GIP/Gcg receptor triagonist | Antidiabetes, Antiobesity | N.A. | 30 nmol/kg | 58.23 ± 2.17 | SD rats serum protease | N.A. | SD rats serum | In Vivo | None | None | EC50 (nM) = 0.12 (In vitro receptor activation profiles of XFL peptides for GLP-1R) | |||
| 32841660 | 2020 | XFL6 | 43 | Free | Free | Linear | L | Modifcation of lysine site at position at 16 with C16 fatty acid | GLP-1/GIP/Gcg receptor triagonist | Antidiabetes, Antiobesity | N.A. | 90 nmol/kg | 75.81 ± 3.58 | SD rats serum protease | N.A. | SD rats serum | In Vivo | None | None | EC50 (nM) = 0.12 (In vitro receptor activation profiles of XFL peptides for GLP-1R) | |||
| 32808659 | 2020 | Fc-ELA-21 | 266 | Fc joined with ELA-21 by linker (GGGS)3 | Free | Linear | L | None | Derived from ELA | Anti-Heart Failure Activity | About 10 μl of blood was collected at each time point of 0, 1, 2, 4, 8, 24, 32, 48, 56, and 72 h after administration | 5 mg/kg | ∼44 | Mice plasma protease | Western blotting | Mice plasma | In Vivo | https://sci-hub.se/10.1016/j.ijcard.2019.04.089 | None | EC50 =1.58 nM (cAMP supression) | |||
| 32736262 | 2020 | EX-ABD | 84 | Free | ABD | Linear | L | None | Synthetic | Antiobesity | Blood was withdrawn at 0, 10 min, 1 h, 3 h, 8 h, 1 day, 2 day, 3 day, 4 day, 7 day, 10 day, and 14 day post-administratio | 50 nmol/kg | 84.02 | ICR mice plasma protease | ELISA | ICR mice plasma | In Vivo | None | None | Kd(M) = 6.97 * 10-8(binding affinities of EX-ABD-AFF to glucagon-like peptide-1 receptor (GLP-1)) | |||
| 32736262 | 2020 | EX-ABD-AFF | 142 | Free | ABD-AFF | Linear | L | None | Synthetic | Antiobesity | blood was withdrawn at 0, 10 min, 1 h, 3 h, 8 h, 1 day, 2 day, 3 day, 4 day, 7 day, 10 day, and 14 day post-administratio | 50 nmol/kg | 166.4 | ICR mice plasma protease | ELISA | ICR mice plasma | In Vivo | None | None | Kd(M) = 6.97 * 10-8(binding affinities of EX-ABD-AFF to glucagon-like peptide-1 receptor (GLP-1)) | |||
| 32736262 | 2020 | EX-ABD-AFF | 142 | Free | ABD-AFF | Linear | L | None | Synthetic | Antiobesity | blood was withdrawn at 0, 10 min, 1 h, 3 h, 8 h, 1 day, 2 day, 3 day, 4 day, 7 day, 10 day, and 14 day post-administratio | 50 nmol/kg | 140.2 | ICR mice plasma protease | ELISA | ICR mice plasma | In Vivo | None | None | Kd(M) = 6.97 * 10-8(binding affinities of EX-ABD-AFF to glucagon-like peptide-1 receptor (GLP-1)) | |||
| 32506501 | 2020 | des-Ac-a-MSH | 14 | Free | Amidation | Linear | L | None | Derived from POMC | Antiinflammatory, Antipyretic | 37 °C | 2 µM | 32.06 | Human plasma protease | Glo-sensor transfected cell-based luminescence assay | Human CSF | In Vitro | None | None | EC50 (M) = 1.667E-09 for MC1R-des-Ac-a-MSH | |||
| 32506501 | 2020 | ACTH | 39 | Free | Free | Linear | L | None | Derived from POMC | Stimulates the adrenal glands to release cortisol | 37 °C | 2 µM | 86.33 | Human CSF protease | Glo-sensor transfected cell-based luminescence assay | Human CSF | In Vitro | None | None | EC50 (M) = 1.54E-09 for MC1R-ACTH | |||
| 32464231 | 2020 | FP-EGCG-NPs | 3 | Free | Folate peptide (FA-Pep-1) conjugated to EGCG-loaded nanoparticles (EGCG-NPs) | Linear | L | None | Polyphenolic constituent of green tea | Antitumor (Against Mda-Mb-231 Tumor Xenograft) | blood samples were collected at different time intervals (0.5, 1, 2, 4, 6, 8, 12, 24 and 48 h post-administration | 0.1 mL | 25.13 ± 8.62 | Male SD rats plasma protease | HPLC | Male SD rats plasma | In Vivo | None | None | IC50 = 15.56 for FP-EGCG-NPs(µg/mL) in MDA-MB-231 | |||
| 32387412 | 2020 | DIG-2 | 62 | Free | bisMal-PEG(10KDa) | Linear | L | Radioiodinated , A8G, G31C modification in GLP-1 | DIG conjugates | Antidiabetes | The collected samples at predose, 0.5, 1, 2, 4, 8, 24, 36, 48, 96, 144 and 168 h were stored at −80 °C | 50 nmol/kg | 62.6 | Cynomolgus monkeys plasma protease | RP-HPLC | Cynomolgus monkeys plasma | In Vivo | None | None | kd (1/s) = 6.54 × 10−3 (binding results for DIG conjugates 2 with human GLP-1R ECD | |||
| 32387412 | 2020 | DIG-2 | 62 | Free | bisMal-PEG(10KDa) | Linear | L | Radioiodinated , A8G, G31C modification in GLP-1 | DIG conjugates | Antidiabetes | The collected samples at predose, 0.5, 1, 2, 4, 8, 24, 36, 48, 96, 144 and 168 h were stored at −80 °C | 100 nmol/kg | 97.2 | Cynomolgus monkeys plasma protease | RP-HPLC | Cynomolgus monkeys plasma | In Vivo | None | None | kd (1/s) = 6.54 × 10−3 (binding results for DIG conjugates 2 with human GLP-1R ECD | |||
| 32387412 | 2020 | DIG-2 | 62 | Free | bisMal-PEG(10KDa) | Linear | L | Radioiodinated , A8G, G31C modification in GLP-1 | DIG conjugates | Antidiabetes | The collected samples at predose, 0.5, 1, 2, 4, 8, 24, 36, 48, 96, 144 and 168 h were stored at −80 °C | 150 nmol/kg | 120.4 | Cynomolgus monkeys plasma protease | RP-HPLC | Cynomolgus monkeys plasma | In Vivo | None | None | kd (1/s) = 6.54 × 10−3 (binding results for DIG conjugates 2 with human GLP-1R ECD | |||
| 32301996 | 2020 | 89Zr-NFP | 13 | mPEG2000, 89Zr labeling | Cy5.5 labelling | Linear | L | None | Synthetic | Diffuse intrinsic pontine glioma treatment | Mice were euthanized after 4 and 21 days for organ collection | 20 μCi | 60.3 | Mice brain homogenize protease | Gamma counter | Mice brain homogenize | In Vivo | None | None | IC50 (nM) = 5.6 ± 0.4 for DM1 in SF8628 | |||
| 32243177 | 2020 | FITC-labeled HFt | 183 | FITC labelled | Free | Linear | L | None | Derived from human Ft | Antidiabetes | At different time points (30 min, 1, 2, 4, 8, 10, 24, 48, 72, and 96 h) after injection | 100 μg | 51.1 | Mice plasma protease | BCA protein assay | Mice plasma | In Vivo | None | None | The GLP-HFt nanocage dose-dependently reduced the nonfasting blood glucose of the STZ-induced diabetic mice | |||
| 32243177 | 2020 | GLP-HFt | 217 | GLP-1 A8G modification linked by GSGG | Free | Linear | L | None | Synthetic | Antidiabetes | At different time points (30 min, 1, 2, 4, 8, 10, 24, 48, 72, and 96 h) after injection | 100 μg | 51.9 | Mice plasma protease | BCA protein assay | Mice plasma | In Vivo | None | None | The GLP-HFt nanocage dose-dependently reduced the nonfasting blood glucose of the STZ-induced diabetic mice | |||
| 35496622 | 2020 | Lixisenatide 1c | 44 | Free | Amidation | Linear | L | (X3) MPAs modification on Lys12 | lixisenatide analogues | Antidiabetes | incubated at 37 °C for 6, 12, 24, and 48 h | 1000 ng/mL | 30 | Rats blood plasma protease | LC-MS/MS | Rats blood plasma | In Vitro | None | None | EC50(nM) = 0.98 ± 0.24 for Lixisenatide 1c (in vitro GLP-1 receptor activation potency) | |||
| 35496622 | 2020 | Lixisenatide 1f | 44 | Free | Amidation | Linear | L | (X3) MPAs modification on Lys12 | lixisenatide analogues | Antidiabetes | incubated at 37 °C for 6, 12, 24, and 48 h | 1000 ng/mL | 33.4 | Rats blood plasma protease | LC-MS/MS | Rats blood plasma | In Vitro | None | None | EC50(nM) = 0.32 ± 0.13 for Lixisenatide 1f (in vitro GLP-1 receptor activation potency) | |||
| 35496622 | 2020 | Lixisenatide 1i | 44 | Free | Amidation | Linear | L | (X3) MPAs modification on Lys12 | lixisenatide analogues | Antidiabetes | incubated at 37 °C for 6, 12, 24, and 48 h | 1000 ng/mL | 31.6 | Rats blood plasma protease | LC-MS/MS | Rats blood plasma | In Vitro | None | None | EC50(nM) = 4.68 ± 0.85 for Lixisenatide 1i (in vitro GLP-1 receptor activation potency) | |||
| 32082972 | 2020 | LMRAP | 291 | Free | hIgG4 Fc-linker-AP25 | Linear | L | None | Synthetic | Antitumor | The experimental sampling time points were: SD rats at 5 min before administration and then 0, 5, 10, 30 min, 1, 2, 4, 6, 8, 12, 24, 36, 48, 72, 96, 120, 144, 168, 192, and 216 h after LMRAP administration | 12.5 mg/kg | 45.237 (Elimination Half Life) | SD rats plasma protease | ELISA | SD rats plasma | In Vivo | None | None | The inhibition rates of each dose of LMRAP at 0.1, 0.2, 0.4, 0.8 and 1.6 μmol/L were 45.8 ± 5.9%, 43.8 ± 18.4%, 57.2 ± 10.2%, 76.6 ± 3.2% and 84.9 ± 2.8%, respectively | |||
| 32082972 | 2020 | LMRAP | 291 | Free | hIgG4 Fc-linker-AP25 | Linear | L | None | Synthetic | Antitumor | The experimental sampling time points were: SD rats at 5 min before administration and then 0, 5, 10, 30 min, 1, 2, 4, 6, 8, 12, 24, 36, 48, 72, 96, 120, 144, 168, 192, and 216 h after LMRAP administration | 12.5 mg/kg | 29.187 (Elimination Half Life) | SD rats plasma protease | ELISA | SD rats plasma | In Vivo | None | None | The inhibition rates of each dose of LMRAP at 0.1, 0.2, 0.4, 0.8 and 1.6 μmol/L were 45.8 ± 5.9%, 43.8 ± 18.4%, 57.2 ± 10.2%, 76.6 ± 3.2% and 84.9 ± 2.8%, respectively | |||
| 32082972 | 2020 | LMRAP | 291 | Free | hIgG4 Fc-linker-AP25 | Linear | L | None | Synthetic | Antitumor | The experimental sampling time points were: SD rats at 5 min before administration and then 0, 5, 10, 30 min, 1, 2, 4, 6, 8, 12, 24, 36, 48, 72, 96, 120, 144, 168, 192, and 216 h after LMRAP administration | 12.5 mg/kg | 50.979 (Eliminatoin Half Life) | SD rats plasma protease | ELISA | SD rats plasma | In Vivo | None | None | The inhibition rates of each dose of LMRAP at 0.1, 0.2, 0.4, 0.8 and 1.6 μmol/L were 45.8 ± 5.9%, 43.8 ± 18.4%, 57.2 ± 10.2%, 76.6 ± 3.2% and 84.9 ± 2.8%, respectively | |||
| 32082972 | 2020 | LMRAP | 291 | Free | hIgG4 Fc-linker-AP25 | Linear | L | None | Synthetic | Antitumor | The experimental sampling time points were: SD rats at 5 min before administration and then 0, 5, 10, 30 min, 1, 2, 4, 6, 8, 12, 24, 36, 48, 72, 96, 120, 144, 168, 192, and 216 h after LMRAP administration | 12.5 mg/kg | 27.879 (Elimination Half Life) | SD rats plasma protease | ELISA | SD rats plasma | In Vivo | None | None | The inhibition rates of each dose of LMRAP at 0.1, 0.2, 0.4, 0.8 and 1.6 μmol/L were 45.8 ± 5.9%, 43.8 ± 18.4%, 57.2 ± 10.2%, 76.6 ± 3.2% and 84.9 ± 2.8%, respectively | |||
| 32082972 | 2020 | LMRAP | 291 | Free | hIgG4 Fc-linker-AP25 | Linear | L | None | Synthetic | Antitumor | The experimental sampling time points were: SD rats at 5 min before administration and then 0, 5, 10, 30 min, 1, 2, 4, 6, 8, 12, 24, 36, 48, 72, 96, 120, 144, 168, 192, and 216 h after LMRAP administration | 12.5 mg/kg | 28.452 (Elimination Half Life) | SD rats plasma protease | ELISA | SD rats plasma | In Vivo | None | None | The inhibition rates of each dose of LMRAP at 0.1, 0.2, 0.4, 0.8 and 1.6 μmol/L were 45.8 ± 5.9%, 43.8 ± 18.4%, 57.2 ± 10.2%, 76.6 ± 3.2% and 84.9 ± 2.8%, respectively | |||
| 32075870 | 2020 | Apraglutide | 33 | Free | Amidation | Linear | L | Gly2, Nle10, D-Phe11, Leu16 modification | Derived from hGLP-2 | Treatment of Short Bowel Syndrome | Blood samples were collected at multiple time points up to 169 h post injection | 0.25 mg/kg | 32.4 ± 6.1 (Terminal Half Life) | Male cynomolgus monkeys plasma protease | LC-MS/MS | Male cynomolgus monkeys | In Vivo | None | None | EC50(nM) = 0.24 for hGLP-2 receptor | |||
| 32075870 | 2020 | Apraglutide | 33 | Free | Amidation | Linear | L | Gly2, Nle10, D-Phe11, Leu16 modification | Derived from hGLP-2 | Treatment of Short Bowel Syndrome | Blood samples were collected at multiple time points up to 169 h post injection | 0.15 mg/kg | 30.1 ± 3.1 (Terminal Half Life) | Göttingen minipigs plasma protease | LC-MS/MS | Göttingen minipigs plasma | In Vivo | None | None | EC50(nM) = 0.24 for hGLP-2 receptor | |||
| 31901754 | 2020 | Compound 16a | 39 | Free | Amidation | Linear | L | Amino acid residues located at 24 substituted by the residues of Exenatide in the same location, Position 16 was replaced by Cys for coupling hybrid peptides with fatty chains | OXM analogs | Antiobesity, Antidiabetes | At 0, 1, 2, 4, 6, 8, 12, 24, 36, 48, 72 and 96 h time points, 100 μL of mixture was aliquoted | 1000 ng/mL | 71.79 | Rats plasma protease | LC-MS/MS | Rats plasma | In Vitro | None | None | EC50 = 3.8 ± 0.4 pM for mGLP1R | |||
| 31786794 | 2020 | DR10601 | 15 | Free | IgG4 hinge-Fc fragment | Linear | L | None | Synthetic | Antiobesity, Antidiabetes | Blood samples were collected at 3, 8, 24, 36, 48, 72, 96, 120, 144 and 168 h after administration | 16.3 nmol/kg | 51.9 ± 12.2 | SD rats serum protease | ELISA | SD rats serum | In Vivo | None | None | (EC50) value of DR10601 for GCGR was 37.39±3.95 nmol/L | |||
| N.A. | 2020 | HA-Aib-Linker-SEQ ID No. 5 | 40 | HA = Hyaluronic acid hydrogel linked with GLP-1 analogue | Amidation | Linear | Mix | Linker Z = Structure mentioned in patent, dSer substituitions at position 2 | GLP-1-Linker-Ha Conjugate | Antidiabetes, Antiobesity | Plasma sample were taken at 0,1,4,8,24,48 H And Once A Day On Day 3 to 21 at the same time | 0.623 mg/kg | 139 | Minipigs plasma protease | LC-MS/MS | Minipigs plasma | In Vivo | None | US 201715829596 A | EC50 hGLP-1R = 1.9 pM for Sequence No. 5 | |||
| 31818212 | 2019 | RELAX10 | 309 | Free | Free | Linear | L | Fusion of Human Relaxin 2 with Fc IgG using linker | Human Relaxin analogue | Treatment prevents and reverses isoproterenol induced hypertrophy and fibrosis in mouse heart | Blood samples were collected at various time points after drug administration | 4 mg/kg | 3.59 | Wistar rats plasma protease | ELISA | Wistar rats plasma | In Vivo | https://www.lens.org/lens/patent/078-521-931-782-236/fulltext | None | RELAX10 was active in CHO cells overexpressing the relaxin‐2 receptor, RXFP1, with an average half‐maximal effective concentration value of 1.94 nmol/L | |||
| 31818212 | 2019 | RELAX10 | 309 | Free | Free | Linear | L | Fusion of Human Relaxin 2 with Fc IgG using linker | Human Relaxin analogue | Treatment prevents and reverses isoproterenol induced hypertrophy and fibrosis in mouse heart | Blood samples were collected at various time points after drug administration | 4 mg/kg | 3.75 | Wistar rats plasma protease | ELISA | Wistar rats plasma | In Vivo | https://www.lens.org/lens/patent/078-521-931-782-236/fulltext | None | RELAX10 was active in CHO cells overexpressing the relaxin‐2 receptor, RXFP1, with an average half‐maximal effective concentration value of 1.94 nmol/L | |||
| 31818212 | 2019 | RELAX10 | 309 | Free | Free | Linear | L | Fusion of Human Relaxin 2 with Fc IgG using linker | Human Relaxin analogue | Treatment prevents and reverses isoproterenol induced hypertrophy and fibrosis in mouse heart | Blood samples were collected at various time points after drug administration | 6 mg/kg | 5.58 | Wistar rats plasma protease | ELISA | Wistar rats plasma | In Vivo | https://www.lens.org/lens/patent/078-521-931-782-236/fulltext | None | RELAX10 was active in CHO cells overexpressing the relaxin‐2 receptor, RXFP1, with an average half‐maximal effective concentration value of 1.94 nmol/L | |||
| 31818212 | 2019 | RELAX10 | 309 | Free | Free | Linear | L | Fusion of Human Relaxin 2 with Fc IgG using linker | Human Relaxin analogue | Treatment prevents and reverses isoproterenol induced hypertrophy and fibrosis in mouse heart | Blood samples were collected at various time points after drug administration | 6 mg/kg | 7.06 | Wistar rats plasma protease | ELISA | Wistar rats plasma | In Vivo | https://www.lens.org/lens/patent/078-521-931-782-236/fulltext | None | RELAX10 was active in CHO cells overexpressing the relaxin‐2 receptor, RXFP1, with an average half‐maximal effective concentration value of 1.94 nmol/L | |||
| 31818212 | 2019 | RELAX10 | 309 | Free | Free | Linear | L | Fusion of Human Relaxin 2 with Fc IgG using linker | Human Relaxin analogue | Treatment prevents and reverses isoproterenol induced hypertrophy and fibrosis in mouse heart | Blood samples were collected at various time points after drug administration | 1, 6, or 30 mg/kg | 4.59 - 7.06 | Wistar rats plasma protease | ELISA | Wistar rats plasma | In Vivo | https://www.lens.org/lens/patent/078-521-931-782-236/fulltext | None | RELAX10 was active in CHO cells overexpressing the relaxin‐2 receptor, RXFP1, with an average half‐maximal effective concentration value of 1.94 nmol/L | |||
| 31805154 | 2019 | IBP-CP24 | 37 | IBP conjugation to the N-terminus of CP24 | Free | Linear | L | None | Synthetic | Antiviral (HIV-1 Fusion Inhibitory Peptide) | Serial blood samples were collected from monkeys that received CP24 or IBP-CP24 before injection and at 2, 4, 6, 24, 72 and 144 h post-injection | 10 mg/kg | 46.11 | Rhesus monkeys plasma protease | Sandwich ELISA | Rhesus monkeys plasma | In Vivo | None | None | IC50(nM) = 0.7±0.3 for IBP-CP24 in virus subtype A (92UG029) | |||
| 31615671 | 2019 | Free-ADI | 100 | Free | Free | Linear | L | None | Purified from the mycelia of A. nidulan | Anticancer | 20 days | 100 μl | 50.14 | Mice serum protease | HPLC | Mice serum | In Vivo | None | None | IC50 = 6.3 ± 0.6(μmol/mg/min) in HepG-2 cells | |||
| 31615671 | 2019 | Dextran-ADI | 100 | Free | Free | Linear | L | ADI was conjugated to dextran- reactive aldehyde groups via the formation of aldimine linkage | Purified from the mycelia of A. nidulan | Anticancer | 20 days | 100 μl | 66.8 | Mice serum protease | HPLC | Mice serum | In Vivo | None | None | IC50 = 4.7 ± 0.9 (μmol/mg/min) in HepG-2 cells | |||
| 31389463 | 2019 | PP18 | 49 | Free | Free | Linear | L | Ser23 linked with X3 = Structure givven in paper | OXM analogs | Antidiabetes, Antiobesity | blood was sampled pre-dose and at 0.5, 1, 2, 4, 8, 24, 48, 72, and 96 h post-dose | 30 nmoL/kg | 38.5 ± 5.9 | SD rats plasma protease | LC-MS, ELISA | SD rats plasma | In Vivo | None | None | EC50(nM) = 0.487 for Human GLP-1R | |||
| 31341417 | 2019 | PSG4R | 25 | hIgG4 Fc conjugation through linker AEAAAKEAAAKEAAAKEAAAKA | Free | Cyclic (Two Disulfide Bonds Arranged As Cys2-Cys10 And Cys4-Cys8 In Ap25) | L | None | RGD-4C and endostatin fragment ES-2 fusion protein derived | Antitumor | 100 to 200 µL orbital blood samples were taken at 5 min before drug administration or 0 min, 5 min, 10 min, 30 min, 1 h, 2 h, 4 h, 6 h, 8 h, 12 h, 18 h, 24 h, 36 h, 48 h, 72 h, 96 h, 120 h, 144 h, 168 h, 192 h, 216 h after drug administration | 5 mg/kg | 56.27 (Elimination Half Life) | Rats plasma protease | Indirect competitive ELISA | Rats plasma | In Vivo | None | None | IC50 = 1.82 ± 0.25 μmol/L for PSG4R on HUVEC proliferation | |||
| 31341417 | 2019 | AP25 | 25 | Free | Free | Cyclic (Two Disulfide Bonds Arranged As Cys2-Cys10 And Cys4-Cys8) | L | None | Synthetic | Antitumor | 100 to 200 µL orbital blood samples were taken at 5 min before drug administration or 0 min, 5 min, 10 min, 30 min, 1 h, 2 h, 4 h, 6 h, 8 h, 12 h, 18 h, 24 h, 36 h, 48 h, 72 h, 96 h, 120 h, 144 h, 168 h, 192 h, 216 h after drug administration | 5 mg/kg | 50 (Elimination Half Life) | Rats plasma protease | ELISA | rats plasma | In Vivo | None | None | IC50 = 1.60 ± 0.15μmol/L for AP25 on HUVEC proliferation | |||
| 31235532 | 2019 | TransCon CNP (CNP-38) | 38 | Free | Free | Cyclic (1 Disulfide Bond) | L | 4xPEG10KDa modification at Lys26 through transient linker | CNP-38 analog | Treatment of Comorbidities Associated with Fibroblast Growth Factor Receptor 3–related Skeletal Dysplasias | Blood samples for CNP38 analysis were collected and analyzed following the 1st and the 26th dose at the following time points: 0 (prior to dosing), 6, 12, 24, 36, 48, 72, 96, 120, 144, and 168 hours postdose | 40 μg/kg per week for 26 weeks | 92.6 | Cynomolgus monkeys plasma protease | HPLC-MS/MS | Cynomolgus monkeys plasma | In Vivo | None | None | Ratio IC50 CNP-38/IC50 CNP-38 conjugate = <1 for TransCon CNP (NPR-C Affinity) | |||
| 31235532 | 2019 | TransCon CNP (CNP-38) | 38 | Free | Free | Cyclic (1 Disulfide Bond) | L | 4xPEG10KDa modification at Lys26 through transient linker | CNP-38 analog | Treatment of Comorbidities Associated with Fibroblast Growth Factor Receptor 3–related Skeletal Dysplasias | Blood samples for CNP38 analysis were collected and analyzed following the 1st and the 26th dose at the following time points: 0 (prior to dosing), 6, 12, 24, 36, 48, 72, 96, 120, 144, and 168 hours postdose | 100 μg/kg per week for 26 weeks | 86.7 | Cynomolgus monkeys plasma protease | HPLC-MS/MS | Cynomolgus monkeys plasma | In Vivo | None | None | Ratio IC50 CNP-38/IC50 CNP-38 conjugate = <1 for TransCon CNP (NPR-C Affinity) | |||
| 31235532 | 2019 | 5-kDa PEG-linker CNP-38 | 38 | PEG5KDa through permanent linker | Free | Cyclic (1 Disulfide Bond) | L | None | CNP-38 analog | Treatment of Comorbidities associated with Fibroblast Growth Factor Receptor 3–Related Skeletal Dysplasias | 4 days | 100 μg/ml | 65.4 | Recombinant Human Nep Protease | HPLC-UV | Recombinant human NEP (2.5 mg/ml) + digest buffer (50 mM Tris-HCl, 10 mM NaCl, pH 7.4) | In Vitro | None | None | Ratio IC50 CNP-38/IC50 CNP-38 conjugate = 83 ± 7 (NPR-C Affinity) | |||
| 31156041 | 2019 | AD-114-PA600-6H | 118 | Free | PA-600-6H | Linear | L | None | Fusion protein of AD-114 with PA600 | Attenuates Renal fibrosis through blockade Of CXCR | Blood samples were collected immediately following dosing and at 5, 15, and 30 min and 1, 2, 4, 8, 12, 24, 36, 48, 60, 72, 84, 96, 120, 144, 168, and 192-h post-dosing | 2 mg/kg | 24.27 ± 0.24 | Cynomolgus monkeys plasma protease | LC–MS/MS | Cynomolgus monkeys plasma | In Vivo | PDB id: >5AEA_1 | None | Kd(nM) = 5.2 (Human CXCR4 affinity) for AD-114-Im7-FH-PEG 30K | |||
| 31156041 | 2019 | AD-114-PA600 | 118 | Free | PA-600 | Linear | L | None | Fusion protein of AD-114 with PA600 | Attenuates Renal fibrosis through blockade Of CXCR | Blood samples were collected pre-dosing and at the following time points post each dosing: 30 min, 1, 2, 4, 8, 12, 24, 48, 72, 96, 120, and 144 h | 3 mg/kg | 25.41 ± 5.17 | Cynomolgus monkeys plasma protease | LC–MS/MS | Cynomolgus monkeys plasma | In Vivo | PDB id: >5AEA_1 | None | Kd(nM) = 4 (Human CXCR4 affinity) for AD-114-Im7-FH-PEG 30K | |||
| 31064153 | 2019 | Triazolopeptides compounds 3 | 4 | Free | Free | Linear | L | Lys1 linked with Har = Homo-Arginine, GlyΨ[Trl] is a glycyl-1,2,3-triazole unit mimicking glycine (triazole ring substitution instead of peptide bond) | Derived from triazolopeptide | Inhibits the interaction between Neuropilin-1 and Vascular Endothelial Growth Factor-165 | 37 °C | 1.1 µmol/mL | >> 48 | Human plasma protease | HPLC-MS/MS | Human plasma | In Vitro | None | None | IC50 = 8.39 μM | |||
| 31064153 | 2019 | Triazolopeptides compounds 4 | 4 | D-Lys at the first position which contains Har = Homo-Arginine side chain | Free | Linear | Mix | GlyΨ[Trl] is a glycyl-1,2,3-triazole unit mimicking glycine (triazole ring substitution instead of peptide bond) | Derived from triazolopeptide | Inhibits the interaction between Neuropilin-1 and Vascular Endothelial Growth Factor-165 | 37 °C | 1.1 µmol/mL | >> 48 | Human plasma protease | HPLC-MS/MS | Human plasma | In Vitro | None | None | IC50 = 10.22 μM | |||
| 31064153 | 2019 | Lys(Har)-Dab | 2 | Lys at the first position contains Har = Homo-Arginine side chain | Dab (2,4-diaminobutyric acid) | Linear | L | None | KPPR analogs | Peptidic inhibitor of the VEGF165/NRP-1 interaction | All samples were incubated at 37 °C and 100 µL of aliquots were withdrawn at different time intervals (for 4 and 5: 0, 10, 20, 30, 40, 50, 60, 70, 80 min, 1.5h, 2h, 2.5h, 3h, 4h, 6h | 1.1 µmol/mL | 34 | Human plasma protease | HPLC-MS/MS | Human plasma | In Vitro | None | None | IC50 = 0.2 μM | |||
| 31064153 | 2019 | Peptidotriazoles | 3 | Dap (2,3-diaminopropionic acid) substiuition at 1st position | Free | Linear | L | None | KPPR analogs | Peptidic inhibitor of the VEGF165/NRP-1 interaction | All samples were incubated at 37 °C and 100 µL of aliquots were withdrawn at different time intervals (for 4 and 5: 0, 10, 20, 30, 40, 50, 60, 70, 80 min, 1.5h, 2h, 2.5h, 3h, 4h, 6h | 1.1 µmol/mL | 41 | Human plasma protease | HPLC-MS/MS | Human plasma | In Vitro | None | None | IC50 = 0.2 μM | |||
| 31038930 | 2019 | Exenatide-Fc | 261 | Free | Conjugation between Ex-Mal-DBCO and N3−Lys-Fc | Linear | L | None | Derived from the Lys-Fc directly expressed by Expi293F | Antidiabetes | Blood samples (ca. 0.6 mL) were collected from the posterior aorta 1, 2, 8, 24, 48, 72, 96, 120, and 168 h after administration | 3.13 nmo/kg | 43.8 | Mice plasma protease | ELISA | Mice plasma | In Vivo | PDB id: 7MLL | None | Exenatide-Fc presented similar GLP-1 activities with EC50 values of 1.5 nM | |||
| 31038930 | 2019 | Exenatide-Fc | 261 | Free | Conjugation between Ex-Mal-DBCO and N3−Lys-Fc | Linear | L | None | Derived from the Lys-Fc directly expressed by Expi293F | Antidiabetes | Blood samples (ca. 0.6 mL) were collected from the posterior aorta 1, 2, 8, 24, 48, 72, 96, 120, and 168 h after administration | 12.5 nmol/kg | 40.4 | Mice plasma protease | ELISA | Mice plasma | In Vivo | PDB id: 7MLL | None | Exenatide-Fc presented similar GLP-1 activities with EC50 values of 1.5 nM | |||
| 31038930 | 2019 | Exenatide-Fc | 261 | Free | Conjugation between Ex-Mal-DBCO and N3−Lys-Fc | Linear | L | None | Derived from the Lys-Fc directly expressed by Expi293F | Antidiabetes | Blood samples (ca. 0.6 mL) were collected from the posterior aorta 1, 2, 8, 24, 48, 72, 96, 120, and 168 h after administration | 25 nmol/kg | 87.8 | Mice plasma protease | ELISA | Mice plasma | In Vivo | PDB id: 7MLL | None | Exenatide-Fc presented similar GLP-1 activities with EC50 values of 1.5 nM | |||
| 30938069 | 2019 | ESA-CJC-1295 | 30 | Free | (DAC) maleimidopropionic acid conjugated with Equine serum albumin | Cyclic | Mix | None | Synthetic | Stimulates The Production Of Growth Hormone (Gh) From The Pituitary Gland | One mL aliquots were removed for analysis at 0, 24, 48, 72 and 96 hours at 4°C | 700 pg/mL | 20 | Equine plasma protease | Mass spectrometry | Equine plasma | In Vivo | None | None | N.A. | |||
| 30853651 | 2019 | DiR dye-loaded PAS40 nanoghosts | 120 | Free | Free | Linear | L | None | Synthetic | Increases the circulation time of a cell membrane based nanotherapeutic | Measuring the residual fluorescence intensity of the dye in serum at 0, 8, 24 and 48 h | 50 mg/kg | 37 | Mouse serum protease | Fluorescence assay | Mouse serum | In Vivo | None | None | N.A. | |||
| 30742145 | 2019 | n(BMP-2) | 116 | Free | Free | Linear | L | None | Synthetic | Promotes Bone repair | N.A. | 0.5 mg/kg | 48 | N.A. | Fluorescence spectrometry | Rats | In Vivo | PDB id: 1ES7 | None | n(BMP-2) did not enhance ALP expression in MSCs compared with native BMP-2 unless pretreated with IV collagenase, which significantly enhanced ALP expression and calcium deposition | |||
| 30690406 | 2019 | Apelin3 | 20 | R1 = NH2-Lys-Phe-Arg | Free | Linear | L | R2=Me, Methylation at Glu8 | Apelin analogs | Blood Pressure lowering agents | 37 C for up to 72 h | N.A. | >30 | RHNEP | LC-MS | Apelin3 | In Vitro | None | None | EC50(nM) = 4.9 ± 1.0 | |||
| 30690406 | 2019 | Apelin7 | 20 | R1 = PEG-Lys-Phe-Arg | Free | Linear | L | None | Apelin analogs | Blood Pressure lowering agents | 37 C for up to 72 h | N.A. | >30 | RHNEP | LC-MS | Apelin7 | In Vitro | None | None | EC50(nM) = 6.3 ± 1.0 | |||
| 30690406 | 2019 | Apelin8 | 20 | R1 = PALM-Lys-Phe-Arg | Free | Linear | L | R2= Me, Methylation at Gln8 | Apelin analogs | Blood Pressure lowering agents | 37 C for up to 72 h | N.A. | >30 | RHNEP | LC-MS | Apelin8 | In Vitro | None | None | EC50(nM) = 11.3 ± 2.1 | |||
| 30690406 | 2019 | Apelin9 | 20 | R1 = PEG-Lys-Phe-Arg | Free | Linear | L | R2= Me, Methylation at Gln8 | Apelin analogs | Blood Pressure lowering agents | 37 C for up to 72 h | N.A. | >30 | RHNEP | LC-MS | Apelin9 | In Vitro | None | None | EC50(nM) = 2.5 ± 1.5 | |||
| 30690406 | 2019 | Apelin9 | 20 | R1 = PEG-Lys-Phe-Arg | Free | Linear | L | R2= Me, Methylation at Gln8 | Apelin analogs | Blood Pressure lowering agents | 37 C for up to 72 h | N.A. | 27 | hplasma protease | LC-MS | hplasma | In Vitro | None | None | EC50(nM) = 2.5 ± 1.5 | |||
| 30658804 | 2019 | HTCOSC-ES2 | 11 | Chitooligosaccharide chloride | FITC | Linear | L | None | derived from the C-terminus of endostatin | Antiangiogenic | Immediately, 0.5, 1, 2, 4, 6, 8, 12, 24, and 36 h after injection, blood was collected | 80 mg/kg | 29.17 ± 3.91 | Mice plasma protease | Fluorescence assay | Mice plasma | In Vivo | None | None | Antitumor activity = 68.21% | |||
| 30624060 | 2019 | Compound 7 | 9 | yGlu-(OEG)2 linker between C18 fatty acid and peptide | Amidation | Linear | Mix | sTyr = Sulfated-Tyrosine, Nle = Nor-leucine, DMeAsp = N-methylated DAsp | CCK-8 analogue | Role in the regulation of energy balance | The blood samples were collected at following time points relative to dosing: predose, 0.083, 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 10, 24, 48, 72, 96, 120, 168, 192, 216, 240, 264, and 288 h | 5 nmol/kg | 115 (Terminal Half Life) | Female göttingen minipigs plasma protease | LC-MS | Female göttingen minipigs plasma | In Vivo | None | None | pEC50 = 9.35 (In Vitro CCK-1R Potency) | |||
| 30624060 | 2019 | Compound 8 | 9 | yGlu-(OEG)2 linker between C18 fatty acid and peptide | Amidation | Linear | L | Phe(4sm) = 4-sulfomethylphenylalanine, Nle = Nor-leucine, MeAsp = N-methylated Asp | CCK-8 analogue | Role in the regulation of energy balance | The blood samples were collected at following time points relative to dosing: predose, 0.083, 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 10, 24, 48, 72, 96, 120, 168, 192, 216, 240, 264, and 288 h | 5 nmol/kg | 145 (Terminal Half Life) | Female göttingen minipigs plasma protease | LC-MS | Female göttingen minipigs plasma | In Vivo | None | None | pEC50 = 9.97 (In Vitro CCK-1R Potency) | |||
| 30624060 | 2019 | Compound 9 | 9 | yGlu-(OEG)2 linker between C18 fatty acid and peptide | Amidation | Linear | Mix | Phe(4sm) = 4-sulfomethylphenylalanine, Nle = Nor-leucine, DMeAsp = N-methylated D-Asp, MePhe = Methylated-phenylalanine | CCK-8 analogue | Role in the regulation of energy balance | The blood samples were collected at following time points relative to dosing: predose, 0.083, 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 10, 24, 48, 72, 96, 120, 168, 192, 216, 240, 264, and 288 h | 5 nmol/kg | 113 (Terminal Half Life) | Female göttingen minipigs plasma protease | LC-MS | Female göttingen minipigs plasma | In Vivo | None | None | pEC50 = 9.60 (In Vitro CCK-1R Potency) | |||
| 30624060 | 2019 | Compound 15 | 9 | yGlu-(OEG)2 linker between C16 fatty acid and peptide | Amidation | Linear | Mix | Phe(4sm) = 4-sulfomethylphenylalanine, Nle = Nor-leucine, DMeAsp = N-methylated D-Asp, MePhe = Methylated-phenylalanine | CCK-8 analogue | Role in the regulation of energy balance | The blood samples were collected at following time points relative to dosing: predose, 0.083, 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 10, 24, 48, 72, 96, 120, 168, 192, 216, 240, 264, and 288 h | 5 nmol/kg | 37 (Terminal Half Life) | Female göttingen minipigs plasma protease | LC-MS | Female göttingen minipigs plasma | In Vivo | None | None | pEC50 = 9.72 (In Vitro CCK-1R Potency) | |||
| 30624060 | 2019 | Compound 16 | 9 | yGlu-(OEG)2 linker between C20 fatty acid and peptide | Amidation | Linear | Mix | Phe(4sm) = 4-sulfomethylphenylalanine, Nle = Nor-leucine, DMeAsp = N-methylated D-Asp, MePhe = Methylated-phenylalanine | CCK-8 analogue | Role in the regulation of energy balance | The blood samples were collected at following time points relative to dosing: predose, 0.083, 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 10, 24, 48, 72, 96, 120, 168, 192, 216, 240, 264, and 288 h | 5 nmol/kg | 153 (Terminal Half Life) | Female göttingen minipigs plasma protease | LC-MS | Female göttingen minipigs plasma | In Vivo | None | None | pEC50 = 9.43 (In Vitro CCK-1R Potency) | |||
| 30624060 | 2019 | Compound 17 | 9 | yGlu-PEG10-PEG10 linker between C18 fatty acid and peptide | Amidation | Linear | Mix | Phe(4sm) = 4-sulfomethylphenylalanine, Nle = Nor-leucine, DMeAsp = N-methylated D-Asp, MePhe = Methylated-phenylalanine | CCK-8 analogue | Role in the regulation of energy balance | The blood samples were collected at following time points relative to dosing: predose, 0.083, 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 10, 24, 48, 72, 96, 120, 168, 192, 216, 240, 264, and 288 h | 5 nmol/kg | 103 (Terminal Half Life) | Female göttingen minipigs plasma protease | LC-MS | Female göttingen minipigs plasma | In Vivo | None | None | pEC50 = 9.54 (In Vitro CCK-1R Potency) | |||
| 30624060 | 2019 | Compound 18 | 9 | yGlu-PEG10-PEG10 linker between C18 fatty acid and peptide | Amidation | Linear | Mix | Phe(4sm) = 4-sulfomethylphenylalanine, Nle = Nor-leucine, DMeAsp = N-methylated D-Asp, MePhe = Methylated-phenylalanine | CCK-8 analogue | Role in the regulation of energy balance | The blood samples were collected at following time points relative to dosing: predose, 0.083, 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 10, 24, 48, 72, 96, 120, 168, 192, 216, 240, 264, and 288 h | 5 nmol/kg | 161 (Terminal Half Life) | Female göttingen minipigs plasma protease | LC-MS | Female göttingen minipigs plasma | In Vivo | None | None | pEC50 = 9.50 (In Vitro CCK-1R Potency) | |||
| 30624060 | 2019 | Compound 19 | 10 | C18 fatty acid | Amidation | Linear | Mix | sTyr = Sulfated-Tyrosine, Nle = Nor-leucine, DMeAsp = N-methylated DAsp, MePhe = Methylated-phenylalanine | CCK-8 analogue | Role in the regulation of energy balance | The blood samples were collected at following time points relative to dosing: predose, 0.083, 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 10, 24, 48, 72, 96, 120, 168, 192, 216, 240, 264, and 288 h | 5 nmol/kg | 36 (Terminal Half Life) | Female göttingen minipigs plasma protease | LC-MS | Female göttingen minipigs plasma | In Vivo | None | None | pEC50 = 9.67 (In Vitro CCK-1R Potency) | |||
| 30624060 | 2019 | Compound 25 | 9 | yGlu-(OEG)2 linker between C18 fatty acid and peptide | Amidation | Linear | Mix | Nle = Nor-leucine, DMeAsp = N-methylated D-Asp, MePhe = Methylated-phenylalanine | CCK-8 analogue | Role in the regulation of energy balance | The blood samples were collected at following time points relative to dosing: predose, 0.083, 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 10, 24, 48, 72, 96, 120, 168, 192, 216, 240, 264, and 288 h | 5 nmol/kg | 45 (Terminal Half Life) | Female göttingen minipigs plasma protease | LC-MS | Female göttingen minipigs plasma | In Vivo | None | None | pEC50 = 9.81 (In Vitro CCK-1R Potency) | |||
| 30624060 | 2019 | Compound 30 | 9 | yGlu-(OEG)2 linker between C18 fatty acid and peptide | Amidation | Linear | Mix | sTyr = Sulfated Tyrosine, Nle = Nor-leucine, DMeAsp = N-methylated D-Asp, MePhe = Methylated-phenylalanine | CCK-8 analogue | Role in the regulation of energy balance | The blood samples were collected at following time points relative to dosing: predose, 0.083, 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 10, 24, 48, 72, 96, 120, 168, 192, 216, 240, 264, and 288 h | 5 nmol/kg | 112 (Terminal Half Life) | Female göttingen minipigs plasma protease | LC-MS | Female göttingen minipigs plasma | In Vivo | None | None | pEC50 = 9.44 (In Vitro CCK-1R Potency) | |||
| 30624060 | 2019 | Compound 48 | 9 | yGlu-(OEG)2 linker between C18 fatty acid and peptide | Amidation | Linear | Mix | sTyr = Sulfated Tyrosine, Nle = Nor-leucine, DMeAsp = N-methylated D-Asp, MePhe = Methylated-phenylalanine, Me1Nal = N-methyl-1-naphthylalanine | CCK-8 analogue | Role in the regulation of energy balance | The blood samples were collected at following time points relative to dosing: predose, 0.083, 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 10, 24, 48, 72, 96, 120, 168, 192, 216, 240, 264, and 288 h | 5 nmol/kg | 147 (Terminal Half Life) | Female göttingen minipigs plasma protease | LC-MS | Female göttingen minipigs plasma | In Vivo | None | None | pEC50 = 9.39 (In Vitro CCK-1R Potency) | |||
| 30624060 | 2019 | Compound 49 | 9 | yGlu-(OEG)2 linker between C18 fatty acid and peptide | Amidation | Linear | Mix | sTyr = Sulfated Tyrosine, Nle = Nor-leucine, DMeAsp = N-methylated D-Asp, MePhe = Methylated-phenylalanine, Me1Nal = N-methyl-1-naphthylalanine | CCK-8 analogue | Role in the regulation of energy balance | The blood samples were collected at following time points relative to dosing: predose, 0.083, 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 10, 24, 48, 72, 96, 120, 168, 192, 216, 240, 264, and 288 h | 5 nmol/kg | 140 (Terminal Half Life) | Female göttingen minipigs plasma protease | LC-MS | Female göttingen minipigs plasma | In Vivo | None | None | pEC50 = 9.44 (In Vitro CCK-1R Potency) | |||
| 30624060 | 2019 | Compound 56 | 9 | yGlu-(OEG)2 linker between C18 fatty acid and peptide | Amidation | Linear | Mix | sTyr = Sulfated Tyrosine, Nle = Nor-leucine, DMeAsp = N-methylated D-Asp, MePhe = Methylated-phenylalanine, Phe(4sm) = 4-sulfomethylphenylalanine, βAsp at position 1 | CCK-8 analogue | Role in the regulation of energy balance | The blood samples were collected at following time points relative to dosing: predose, 0.083, 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 10, 24, 48, 72, 96, 120, 168, 192, 216, 240, 264, and 288 h | 5 nmol/kg | 106 (Terminal Half Life) | Female göttingen minipigs plasma protease | LC-MS | Female göttingen minipigs plasma | In Vivo | None | None | pEC50 = 9.50 (In Vitro CCK-1R Potency) | |||
| 30606721 | 2019 | BCY-B3 | 15 | Acetylation | Free | Cyclic (Cyclized With 1,3,5-Trismethylbenzene On C2, C8, C15) | L | None | Bicyclic peptide derivative | For imaging and targeting of proteins overexpressed by tumors | 37C up to 24 hours | 4 μmol/L | >48 | Mouse plasma protease | Radio-HPLC | Mouse plasma | In Vitro | None | None | KD(nM) = 1.22 ± 0.40 | |||
| 30606721 | 2019 | BCY-C3 | 15 | Acetylation | Free | Cyclic (Cyclized With 1,3,5-Trismethylbenzene On C2, C9, C15) | Mix | (1Nal),(D-Ala) at position 3,(tBuGly) at Asp14 | Bicyclic peptide derivative | For imaging and targeting of proteins overexpressed by tumors | 37C up to 24 hours | 4 μmol/L | >48 | Mouse plasma protease | LC-MS | Mouse plasma | In Vitro | None | None | N.A. | |||
| 30606721 | 2019 | BCY-C2. | 15 | Acetylation | Free | Cyclic (Cyclized With 1,3,5-Trismethylbenzene On C2, C9, C15) | Mix | (1Nal),(D-Ala) at position 3,(tBuGly) at Asp14 | Bicyclic peptide derivative | For imaging and targeting of proteins overexpressed by tumors | 37C up to 24 hours | 4 μmol/L | >48 | Mouse plasma protease | Radio-HPLC | Mouse plasma | In Vitro | None | None | KD(nM) = 0.5 ± 0.2 | |||
| 30606721 | 2019 | BCY-B5 | 15 | Acetylation | Free | Cyclic (Cyclized With 1,3,5-Trismethylbenzene On C2, C8, C15) | L | None | Bicyclic peptide derivative | For imaging and targeting of proteins overexpressed by tumors | 37C up to 24 hours | 4 μmol/L | >48 | Human plasma protease | LC-MS/MS | Human plasma | In Vitro | None | None | N.A. | |||
| 30606721 | 2019 | BCY-B3 | 15 | Acetylation | Free | Cyclic (Cyclized With 1,3,5-Trismethylbenzene On C2, C8, C15) | L | None | Bicyclic peptide derivative | For imaging and targeting of proteins overexpressed by tumors | 37C up to 24 hours | 4 μmol/L | >48 | Human plasma protease | Radio-HPLC | Human plasma | In Vitro | None | None | KD(nM) = 1.22 ± 0.40 | |||
| 30606721 | 2019 | BCY-C3 | 15 | Acetylation | Free | Cyclic (Cyclized With 1,3,5-Trismethylbenzene On C2, C9, C15) | Mix | (1Nal),(D-Ala) at position 3,(tBuGly) at Asp14 | Bicyclic peptide derivative | For imaging and targeting of proteins overexpressed by tumors | 37C up to 24 hours | 4 μmol/L | >48 | Human plasma protease | LC-MS | Human plasma | In Vitro | None | None | N.A. | |||
| 30606721 | 2019 | BCY-C2. | 15 | Acetylation | Free | Cyclic (Cyclized With 1,3,5-Trismethylbenzene On C2, C9, C15) | Mix | (1Nal),(D-Ala) at position 3,(tBuGly) at Asp14 | Bicyclic peptide derivative | For imaging and targeting of proteins overexpressed by tumors | 37C up to 24 hours | 4 μmol/L | >48 | Human plasma protease | Radio-HPLC | Human plasma | In Vitro | None | None | KD(nM) = 0.5 ± 0.2 | |||
| 30165247 | 2019 | PoIFNα -C2 | 781 | Free | SPG C2 domain | Linear | L | None | Fusion protein of Ig-binding C2 domain of streptococcal protein G (SPG) with PoIFN-α | Antiviral And Immune Regulatory Effects | Serum samples were collected at 0.5, 2.0, 4.0, 8.0, 12, 24,48, 72, 96, 120 and 144 h post injection | 2.5 mg/kg | 56.82 ± 0.70 | Rats serum protease | ELISA | Rats serum | In Vivo | GenBank accession no. AY345969, X06173.1 | None | On MDBK cell, PoIFNα-C2 protein showed almost 10-fold lower anti-VSV activity (3.0 × 107 U/μM) than that (2.4 × 108 U/μM) of PoIFN-α standard | |||
| 30165247 | 2019 | PoIFNα -C2 | 781 | Free | SPG C2 domain | Linear | L | None | Fusion protein of Ig-binding C2 domain of streptococcal protein G (SPG) with PoIFN-α | Antiviral And Immune Regulatory Effects | Serum samples were collected at 0.5, 2.0, 4.0, 8.0, 12, 24,48, 72, 96, 120 and 144 h post injection | 2.5 mg/kg | 61.58 ± 1.998 | Rats serum protease | ELISA | Rats serum | In Vivo | None | None | On MDBK cell, PoIFNα-C2 protein showed almost 10-fold lower anti-VSV activity (3.0 × 107 U/μM) than that (2.4 × 108 U/μM) of PoIFN-α standard | |||
| 30309736 | 2018 | PE | 40 | Free | PEG(20k) | Linear | L | None | Exendin-4 analogs | Antidiabetes | Blood samples were collected at 0, 0.5, 1, 2, 3, 4, 6, 8, 12, 24, 48, 72,96, and 144 h | 100 nmoL/kg | 31.4 ± 1.6 | SD rats serum protease | ELISA | SD rats serum | In Vivo | PDB id: 1JRJ | None | EC50 values of Exendin-4, those of PE to activate GLP-1R in vitro was slightly decreased by 6.9- fold | |||
| 30309736 | 2018 | PE | 40 | Free | PEG(20k) | Linear | L | None | Exendin-4 analogs | Antidiabetes | Blood samples were collected at 0, 0.5, 1, 2, 3, 4, 6, 8, 12, 24, 48, 72,96, and 144 h | 200 nmol/kg | 31.7 ± 1.5 | SD rats serum protease | ELISA | SD rats serum | In Vivo | None | None | EC50 values of Exendin-4, those of PE to activate GLP-1R in vitro was slightly decreased by 6.9- fold | |||
| 30309736 | 2018 | PE | 40 | Free | PEG(20k) | Linear | L | None | Exendin-4 analogs | Antidiabetes | Blood samples were collected at 0, 0.5, 1, 2, 3, 4, 6, 8, 12, 24, 48, 72,96, and 144 h | 400 nmol/kg | 30.7 ± 2.2 | SD rats serum protease | ELISA | SD rats serum | In Vivo | None | None | EC50 values of Exendin-4, those of PE to activate GLP-1R in vitro was slightly decreased by 6.9- fold | |||
| 30309736 | 2018 | PE | 40 | Free | PEG(20k) | Linear | L | Introduction of Cys at C terminal of Exendin-4 | Exendin-4 analogs | Antidiabetes | For 33 consecutive days, after the first administration for 6 days,eight rats received PE (100 nmoL/kg, 200 mL, s.c.) once every 84 h | 100 nmoL/kg | 27.6 ± 5.1 | SD rats serum protease | ELISA | SD rats serum | In Vivo | None | None | EC50 values of Exendin-4, those of PE to activate GLP-1R in vitro was slightly decreased by 6.9- fold | |||
| 30174173 | 2018 | GsMTx4 | 35 | Free | Free | Linear | L | None | Isolated from the venom of the spider Grammostola spatulata | Treatment of Duchenne Muscular Dystrophy | 6 times over 14 days – sacrifice on day 28 | 10 mg/kg | 1 | Mice plasma protease | LC-MS | Mice plasma | In Vivo | https://pmc.ncbi.nlm.nih.gov/articles/PMC2217226/ | None | 1 μM GsMTx4 in vitro experiments shows 0.1–5.0 μM effective in suppressing MSC activity in various disease models | |||
| 30023916 | 2018 | Conjugate 2 | 31 | CH90 linked by linker EDA–(LMDS) | Free | Linear | L | Substituition of G for A at position 2 | Synthetic | Antidiabetes | Blood samples were collected from the tail vein at 0, 12, 24, 48, 72, 96, 120, and 144 h postadministration | 300 nmol/kg | 25.3 (T1/2 Elimination Half life) | Mice plasma protease | ELISA | Mice plasma | In Vivo | None | None | EC50 = 9.9 nM | |||
| 30023916 | 2018 | Conjugate 2 | 31 | CH90 linked by linker EDA–(LMDS) | Free | Linear | L | Substituition of G for A at position 2 | Synthetic | Antidiabetes | Blood samples were collected from the tail vein at 0, 12, 24, 48, 72, 96, 120, and 144 h postadministration | 300 nmol/kg | 30.3 (T1/2 Elimination Half life) | Mice plasma protease | ELISA | Mice plasma | In Vivo | None | None | EC50 = 9.9 nM | |||
| 30023916 | 2018 | Conjugate 3 | 31 | Free | HPN50 linked by linker EDA–(LMDS) | Linear | L | Substituition of G for A at position 2 | Synthetic | Antidiabetes | Blood samples were collected from the tail vein at 0, 12, 24, 48, 72, 96, 120, and 144 h postadministration | 300 nmol/kg | 33.6 (T1/2 Elimination Half life) | Mice plasma protease | ELISA | Mice plasma | In Vivo | None | None | EC50 = 7.0 nM | |||
| 30023916 | 2018 | Conjugate 3 | 31 | Free | HPN50 linked by linker EDA–(LMDS) | Linear | L | Substituition of G for A at position 2 | Synthetic | Antidiabetes | Blood samples were collected from the tail vein at 0, 12, 24, 48, 72, 96, 120, and 144 h postadministration | 300 nmol/kg | 25.8 (T1/2 Elimination Half life) | Mice plasma protease | ELISA | Mice plasma | In Vivo | None | None | EC50 = 7.0 nM | |||
| 30023916 | 2018 | 10 kDa PEG-modified GLP-1 | 31 | PEG10K | Free | Linear | L | None | Synthetic | Antidiabetes | 37 °C for 2 h | N.A. | 105.5 (T1/2 Elimination Half life) | 0.125 U/12.5 Μl C-Abc And 0.0125 U/12.5 Μl Chondroitinase Acii | HPLC | N.A. | In Vitro | None | None | N.A. | |||
| 30012756 | 2018 | Murepavadin | 14 | Free | Free | Cyclic (N-C terminal end) | Mix | Acetate | Synthetic | Antimicrobial | Blood samples were taken predose and 1, 2, 3, 3.5, 4, 5, 6, 9, 15, and 27 h after the start of infusion. For subjects with renal impairment, additional samples were taken at 30, 36, and 48 h, and at 72 h for subjects with severe renal function impairment | 2.2 mg/kg | 24.1 | Human plasma protease | LC-MS with electrospray ionization assay | Human plasma (Severe Renal impairment group) | In Vivo | https://sci-hub.st/10.1080/14787210.2018.1441024 | None | MIC50 = 0.12 mg/L against P. aeruginosa | |||
| 29799205 | 2018 | Liraglutide | 32 | Free | Free | Linear | L | Lys-34 is replaced by Arg and Lys-26 is acylated with a C16 palmitic acid linkd with γGlu | GLP-1 analogs | Antidiabetes | 37°C over 72 h | 1000 ng/mL | 35.4 | SD rats plasma protease | LC-MS/MS. | Rats plasma | In Vitro | None | None | N.A. | |||
| 29799205 | 2018 | 4b | 29 | Free | Free | Linear | L | X2 = structure given in paper | Xenopus GLP-1 analogs | Antidiabetes | 37°C over 72 h | 1000 ng/mL | 27.7 | Rats plasma protease | LC-MS/MS. | Rats plasma | In Vitro | None | None | EC50(nM) = 0.97 ± 0.11 | |||
| 29799205 | 2018 | 4c | 29 | Free | Free | Linear | L | X3 = structure given in paper | Xenopus GLP-1 analogs | Antidiabetes | 37°C over 72 h | 1000 ng/mL | 37.7 | Rats plasma protease | LC-MS/MS. | Rats plasma | In Vitro | None | None | EC50(nM) = 1.49 ± 0.13 | |||
| 29799205 | 2018 | 4e | 29 | Free | Free | Linear | L | X2 = structure given in paper | Xenopus GLP-1 analogs | Antidiabetes | 37°C over 72 h | 1000 ng/mL | 29.4 | Rats plasma protease | LC-MS/MS. | Rats plasma | In Vitro | None | None | EC50(nM) = 1.68 ± 0.18 | |||
| 29799205 | 2018 | 4f | 29 | Free | Free | Linear | L | X3 = structure given in paper | Xenopus GLP-1 analogs | Antidiabetes | 37°C over 72 h | 1000 ng/mL | 37.3 | Rats plasma protease | LC-MS/MS. | Rats plasma | In Vitro | None | None | EC50(nM) =6.35 ± 0.39 | |||
| 29799205 | 2018 | 4h | 38 | Free | Free | Linear | L | X2 = structure given in paper | Xenopus GLP-1 analogs | Antidiabetes | 37°C over 72 h | 1000 ng/mL | 31.6 | Rats plasma protease | LC-MS/MS. | Rats plasma | In Vitro | None | None | EC50(nM) = 0.57 ± 0.19 | |||
| 29799205 | 2018 | 4i | 38 | Free | Free | Linear | L | X3 = structure given in paper | Xenopus GLP-1 analogs | Antidiabetes | 37°C over 72 h | 1000 ng/mL | 39.5 | Rats plasma protease | LC-MS/MS. | Rats plasma | In Vitro | None | None | EC50(nM) =0.88 ± 0.43 | |||
| 29799205 | 2018 | 4j | 38 | Free | Free | Linear | L | X1 = structure given in paper | Xenopus GLP-1 analogs | Antidiabetes | 37°C over 72 h | 1000 ng/mL | 24.1 | Rats plasma protease | LC-MS/MS. | Rats plasma | In Vitro | None | None | EC50(nM) = 0.31 ± 0.03 | |||
| 29799205 | 2018 | 4k | 38 | Free | Free | Linear | L | X2 = structure given in paper | Xenopus GLP-1 analogs | Antidiabetes | 37°C over 72 h | 1000 ng/mL | 30.1 | Rats plasma protease | LC-MS/MS. | Rats plasma | In Vitro | None | None | EC50(nM) = 0.68 ± 0.24 | |||
| 29799205 | 2018 | 4l | 38 | Free | Free | Linear | L | X3 = structure given in paper | Xenopus GLP-1 analogs | Antidiabetes | 37°C over 72 h | 1000 ng/mL | 40.5 | Rats plasma protease | LC-MS/MS. | Rats plasma | In Vitro | None | None | EC50(nM) = 2.09 ± 0.21 | |||
| 29799205 | 2018 | 4n | 43 | Free | Free | Linear | L | X2 = structure given in paper | Xenopus GLP-1 analogs | Antidiabetes | 37°C over 72 h | 1000 ng/mL | 26.6 | Rats plasma protease | LC-MS/MS. | Rats plasma | In Vitro | None | None | EC50(nM) = 0.44 ± 0.11 | |||
| 29799205 | 2018 | 4o | 43 | Free | Free | Linear | L | X3 = structure given in paper | Xenopus GLP-1 analogs | Antidiabetes | 37°C over 72 h | 1000 ng/mL | 36.4 | Rats plasma protease | LC-MS/MS. | Rats plasma | In Vitro | None | None | EC50(nM) = 0.98 ± 0.18 | |||
| 29799205 | 2018 | 4q | 43 | Free | Free | Linear | L | X2 = structure given in paper | Xenopus GLP-1 analogs | Antidiabetes | 37°C over 72 h | 1000 ng/mL | 27.2 | Rats plasma protease | LC-MS/MS. | Rats plasma | In Vitro | None | None | EC50(nM) = 0.48 ± 0.08 | |||
| 29799205 | 2018 | 4r | 43 | Free | Free | Linear | L | X3 = structure given in paper | Xenopus GLP-1 analogs | Antidiabetes | 37°C over 72 h | 1000 ng/mL | 38.7 | Rats plasma protease | LC-MS/MS. | Rats plasma | In Vitro | None | None | EC50(nM) = 0.61 ± 0.24 | |||
| 29732120 | 2018 | Analogue 11 and 9b | 5 | Free | Free | Macrocyclic (N-C terminal end) | Mix | Thio substiuition in Asp (analogue 11) and Phe (analogue 9b) | Synthetic | Inhibits pro-angiogenic integrins | At various time points (0, 1, 3, 5. 7, 9, 12, 24, 36, 48, 60 and 72 h) | 1 mg/ml | 36 | Human serum protease | HPLC | Human serum | In Vitro | None | None | IC50 value of 11 shows that 11 is poorer than Cilen | |||
| 29693715 | 2018 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | Antidiabetes | Blood samples were taken on day 1 at up to 30 minutes prior to the first administration of semaglutide and 1 hour after dosing; predose on days 2, 4, 6, 8, and 9; on day 10 at up to 30 minutes predose | 5 mg for 5 days followed by 10 mg for 5 days | 156.4 | Human plasma protease | LC‐MS/MS | Human plasma (Normal hepatic function) after 10th dosing | In Vivo | None | None | N.A. | |||
| 29693715 | 2018 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | Antidiabetes | Blood samples were taken on day 1 at up to 30 minutes prior to the first administration of semaglutide and 1 hour after dosing; predose on days 2, 4, 6, 8, and 9; on day 10 at up to 30 minutes predose | 5 mg for 5 days followed by 10 mg for 5 days | 142.1 | Human plasma protease | LC‐MS/MS | Human plasma (Mild hepatic function) after 10th dosing | In Vivo | None | None | N.A. | |||
| 29693715 | 2018 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | Antidiabetes | Blood samples were taken on day 1 at up to 30 minutes prior to the first administration of semaglutide and 1 hour after dosing; predose on days 2, 4, 6, 8, and 9; on day 10 at up to 30 minutes predose | 5 mg for 5 days followed by 10 mg for 5 days | 146.7 | Human plasma protease | LC‐MS/MS | Human plasma (Moderate hepatic function) after 10th dosing | In Vivo | None | None | N.A. | |||
| 29693715 | 2018 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | Antidiabetes | Blood samples were taken on day 1 at up to 30 minutes prior to the first administration of semaglutide and 1 hour after dosing; predose on days 2, 4, 6, 8, and 9; on day 10 at up to 30 minutes predose | 5 mg for 5 days followed by 10 mg for 5 days | 153.7 | Human plasma protease | LC‐MS/MS | Human plasma (Severe hepatic function) after 10th dosing | In Vivo | None | None | N.A. | |||
| 29623579 | 2018 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | Antidiabetes | After 10th dosing | 5 days of semaglutide 5 mg followed by 5 days of semaglutide 10 mg | 151.7 | Human plasma protease | LC–MS/MS | Human plasma (Normal renal function) | In Vivo | https://pmc.ncbi.nlm.nih.gov/articles/PMC8736331/ | None | N.A. | |||
| 29623579 | 2018 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | Antidiabetes | After 10th dosing | 5 days of semaglutide 5 mg followed by 5 days of semaglutide 10 mg | 159.3 | Human plasma protease | LC–MS/MS | Human plasma (Mild renal function ) | In Vivo | None | None | N.A. | |||
| 29623579 | 2018 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | Antidiabetes | After 10th dosing | 5 days of semaglutide 5 mg followed by 5 days of semaglutide 10 mg | 162.8 | Human plasma protease | LC–MS/MS | Human plasma (Moderate renal function) | In Vivo | None | None | N.A. | |||
| 29623579 | 2018 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | Antidiabetes | After 10th dosing | 5 days of semaglutide 5 mg followed by 5 days of semaglutide 10 mg | 164.9 | Human plasma protease | LC–MS/MS | Human plasma (Severe renal function group) | In Vivo | None | None | N.A. | |||
| 29623579 | 2018 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | GLP-1 analogs | Antidiabetes | After 10th dosing | 5 days of semaglutide 5 mg followed by 5 days of semaglutide 10 mg | 152.8 | Human plasma protease | LC–MS/MS | Human plasma (ESRD Renal function group) | In Vivo | None | None | N.A. | |||
| 29577579 | 2018 | Fc‐apelin‐13 fusion protein | 12 | Fc linked by (GGGS)3 linker at N terminus | Free | Linear | L | None | Fc‐apelin‐13 fusion protein | Antidiabetes and Anti‐Heart Failure Activities | About 10 μL of blood was collected at each time point of 0, 1, 2, 4, 8, 24, 32, 48, 56, and 72 hours after administration | 5 mg/kg | ~33 | Mice Plasma Protease | Western blotting | Mice plasma | In Vivo | None | None | EC50 values of the Fc‐apelin‐13 fusion protein= 12.0 ± 1.1 nM for cAMP suppression | |||
| 29536338 | 2018 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | Antidiabetes | GLP-1R agonist | Blood samples for pharmacokinetic assessment of semaglutide were taken before the first dose (0 h), for 1 week following a single 0.25 mg dose(6, 12, 18, 24, 30, 36, 42, 48, 60, 72, 84, 96, 120,144, 168 h), then weekly prior to the next dose(trough values), and for 5 weeks following thefinal dose (0 h then 6, 12, 18, 24, 30, 36, 42, 48,60, 72, 84, 96, 120, 144, 168, 336, 504, 672 and 840 h). | 0.5 mg | 145 | Human plasma protease | LC–MS/MS | Human plasma (Japanese subjects) | In Vivo | None | None | N.A. | |||
| 29536338 | 2018 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | Antidiabetes | GLP-1R agonist | Blood samples for pharmacokinetic assessment of semaglutide were taken before the first dose (0 h), for 1 week following a single 0.25 mg dose(6, 12, 18, 24, 30, 36, 42, 48, 60, 72, 84, 96, 120,144, 168 h), then weekly prior to the next dose(trough values), and for 5 weeks following thefinal dose (0 h then 6, 12, 18, 24, 30, 36, 42, 48,60, 72, 84, 96, 120, 144, 168, 336, 504, 672 and 840 h). | 1 mg | 163 | Human plasma protease | LC–MS/MS | Human plasma (Japanese subjects) | In Vivo | None | None | N.A. | |||
| 29536338 | 2018 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | Antidiabetes | GLP-1R agonist | Blood samples for pharmacokinetic assessment of semaglutide were taken before the first dose (0 h), for 1 week following a single 0.25 mg dose(6, 12, 18, 24, 30, 36, 42, 48, 60, 72, 84, 96, 120,144, 168 h), then weekly prior to the next dose(trough values), and for 5 weeks following thefinal dose (0 h then 6, 12, 18, 24, 30, 36, 42, 48,60, 72, 84, 96, 120, 144, 168, 336, 504, 672 and 840 h). | 0.5 mg | 159 | Human plasma protease | LC–MS/MS | Human plasma (Caucasian subjects) | In Vivo | None | None | N.A. | |||
| 29536338 | 2018 | Semaglutide | 31 | Free | Free | Linear | L | Aib modification at position 2, Lys26 side chain conjugated with (ADO-linker-Glu-C18) | Antidiabetes | GLP-1R agonist | Blood samples for pharmacokinetic assessment of semaglutide were taken before the first dose (0 h), for 1 week following a single 0.25 mg dose(6, 12, 18, 24, 30, 36, 42, 48, 60, 72, 84, 96, 120,144, 168 h), then weekly prior to the next dose(trough values), and for 5 weeks following thefinal dose (0 h then 6, 12, 18, 24, 30, 36, 42, 48,60, 72, 84, 96, 120, 144, 168, 336, 504, 672 and 840 h). | 1 mg | 167 | Human plasma protease | LC–MS/MS | Human plasma (Caucasian subjects) | In Vivo | None | None | N.A. | |||
| 29517911 | 2018 | 2d | 13 | Acetylation | Free | Bicyclic (Cyclized On C1, C7, C13 By 1,3,5 Trismethylbenzene) | L | Trp3 → Phe3, Pro4 → Aze4, Ala5 → Tyr5, Arg6 → HArg6, Leu8 → Ala(ψCH2NH)6 substituitions | 2a analogue | Antidiabetes (Treatment of Diabetic Macular Edema) | The animals were sacrificed 15 min, 1 h, 4 h, 8 h, 24 h, 48, and 96 h after injection | 2 mg/mL | 39 ± 2 | Rabbit eye plasma protease | HPLC | Rabbit eye plasma | In Vivo | None | None | Ki Values (nM) = 3,400 ± 200 against PKal from Rabbit | |||
| 29421564 | 2018 | HDL-SP | 34 | MPB-Mal modified, additional cysteine residue on N-terminus of SP | Free | Linear | L | None | Synthetic | Therapeutic Angiogenesis in Diabetic Hindlimb Ischemia | 0 to 72 h at 37°C | 5 nmol | 117 | Human serum protease | ELISA | Human serum | In Vitro | None | None | N.A. | |||
| 29421564 | 2018 | HDL-SP | 34 | MPB-Mal modified, additional cysteine residue on N-terminus of SP | Free | Linear | L | None | Synthetic | Therapeutic Angiogenesis in Diabetic Hindlimb Ischemia | 0 to 72 h at 37°C | 5 nmol | 30 | Diabetic rats serum protease | ELISA | Diabetic rats serum | In Vitro | None | None | N.A. | |||
| 29421564 | 2018 | HDL-SP | 34 | MPB-Mal modified, additional cysteine residue on N-terminus of SP | Free | Linear | L | None | Synthetic | Therapeutic Angiogenesis In Diabetic Hindlimb Ischemia | 0 to 72 h at 37°C | 5 nmol | 60 | Mice serum protease | ELISA | Mice serum | In Vivo | None | None | N.A. | |||
| 29421564 | 2018 | HDL-SP | 34 | MPB-Mal modified, additional cysteine residue on N-terminus of SP | Free | Linear | L | None | Synthetic | Therapeutic Angiogenesis In Diabetic Hindlimb Ischemia | 0 to 72 h at 37°C | 5 nmol | 96 | Diabetic rats serum protease | ELISA | Diabetic rats serum | In Vitro | None | None | N.A. | |||
| 28954201 | 2018 | RTD-1 | 18 | Free | Free | Cyclic | L | None | Derived from rhesus | Attenuates Endotoxin-Induced Acute Lung Injury | Received RTD-1 at 0, 0.2, 1,5, or 25 mg/kg 0.5 hour before LPS challenge | 5 or 25 mg/kg | 30 (Terminal Half Life) | Mice plasma protease | LC-MS | Mice plasma (LPS-challenged ) | In Vivo | https://pmc.ncbi.nlm.nih.gov/articles/PMC3024902/ | None | IC50= 4.5 μg/ml | |||
| 28741871 | 2017 | RG7697 | 40 | Free | Acylated at a C-terminal lysine with a saturated C16 lipid | Cyclic (L14-E21, Q17-N24 Lactam Bridge) | L | Aib modification at position 2, 20 | chimera of GLP-1 and GIP peptides | Antidiabetes | RG7697 were collected in EDTA-containing tubes initially at predose, 1, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 24, 30, 36, 48, 60, 72 and 96 hours post dose, and at follow-up visit (first 2 cohorts). In later cohorts, additional time points were collected at 2.5, 3 and 3.5 hours post dose, while the 96-hour sample was deleted | 1.8 mg | 25.4 (T1/2b- Appearant Terminal Half Life) | Human plasma protease | LC-MS | Human plasma | In Vivo | None | None | for human GLP-1 (EC50 = 5 pM) and GIP (EC50 = 3 pM) receptors | |||
| 28619366 | 2017 | BPI-3016 | 30 | Free | Free | Linear | L | substituting –NHCO– amide bond of Ala2 with –CH(CF3)NH– to form (A'), Lys20 conjugation with C18, K34R modification | hGLP-1 analogs | Antidiabetes | Blood samples collected at −2 (pre-administration), 2, 8, 22, 46, 94, 118, 142, and 166 h after administration | 0.2 mg/kg | 95 ± 20 | Diabetic cynomoglus monkeys plasma protease | electrospray ionization LC–MS/MS | Diabetic cynomoglus monkeys plasma | In Vivo | None | None | Single subcutaneous injection of 0.4 mg/kg BPI-3016 significantly lowered the fasting glucose level at 46 h after administration | |||
| 28605180 | 2017 | MS-exenatide (MeSO2-) | 39 | Tetra PEG hydrogel linked with exenatide using linker MeSO2- | Amidation | Linear | L | None | Exenatide analogs | Antidiabetes | Blood samples (300 µL) were drawn at 0, 1, 2, 4, 8, 24, 48, 72, 120, 168, 240, 336, 432, 504, 600, 672 h for both linkers and additional samples were obtained at 840, 1008, 1176, 1344, 1512, 1680, 1848, and 2016 h for the linker with Mod = CN | 1.3 µmol/g | 244 | Mouse serum protease | LC-MS/MS | Mouse serum | In Vivo | PDB id: 7MLL | None | IC50(nM) = 0.21 ±0.0 for exenatide | |||
| 28605180 | 2017 | MS-exenatide (-CN) | 39 | Tetra PEG hydrogel linked with exenatide using linker -CN | Amidation | Linear | L | None | Exenatide analogs | Antidiabetes | Blood samples (300 µL) were drawn at 0, 1, 2, 4, 8, 24, 48, 72, 120, 168, 240, 336, 432, 504, 600, 672 h for both linkers and additional samples were obtained at 840, 1008, 1176, 1344, 1512, 1680, 1848, and 2016 h for the linker with Mod = CN | 1.4 µmol/g | 730 | Mouse serum protease | LC-MS/MS | Mouse serum | In Vivo | PDB id: 7MLL | None | IC50(nM) = 0.21 ±0.0 for exenatide | |||
| 28605180 | 2017 | MS-exenatide (MeSO2-) | 39 | Tetra PEG hydrogel linked with exenatide using linker MeSO2- | Amidation | Linear | L | None | Exenatide analogs | Antidiabetes | Blood samples (300 µL) were drawn at 0, 1, 2, 4, 8, 24, 48, 72, 120, 168, 240, 336, 432, 504, 600, 672 h for both linkers and additional samples were obtained at 840, 1008, 1176, 1344, 1512, 1680, 1848, and 2016 h for the linker with Mod = CN | 1.3 µmol/g | 310 | Rats serum protease | LC-MS/MS | Rats serum | In Vivo | PDB id: 7MLL | None | IC50(nM) = 0.21 ±0.0 for exenatide | |||
| 28605180 | 2017 | MS-exenatide (-CN) | 39 | Tetra PEG hydrogel linked with exenatide using linker -CN | Amidation | Linear | L | None | Exenatide analogs | Antidiabetes | Blood samples (300 µL) were drawn at 0, 1, 2, 4, 8, 24, 48, 72, 120, 168, 240, 336, 432, 504, 600, 672 h for both linkers and additional samples were obtained at 840, 1008, 1176, 1344, 1512, 1680, 1848, and 2016 h for the linker with Mod = CN | 1.4 µmol/g | 880 | Rats serum protease | LC-MS/MS | Rats serum | In Vivo | PDB id: 7MLL | None | IC50(nM) = 0.21 ±0.0 for exenatide | |||
| 28437610 | 2017 | m-exendin-4 | 39 | Free | Amidation | Linear | L | None | GLP-1 analogs | Antidiabetes | N.A. | 25 nmol/kg | 43.11 | Murine plasma protease | ELISA | Murine plasma | In Vivo | PDB id: 7MLL | None | N.A. | |||
| 28389388 | 2017 | PEG-HsTX1[R14A] | 34 | PEGylation | Amidation | Cyclic (C3-C24, C9-C29, C13-C34 Disulfide Linkage) | L | Substituting arginine 14 with alanine | From scorpion Heterometrus spinnifer | Immunomodulation in Inflammatory Arthritis | 2 hours | 1 mg/kg | 37.3 | Lewis rats serum protease | Anti-PEG ELISA | Lewis rats serum | In Vivo | https://pmc.ncbi.nlm.nih.gov/articles/PMC3968461/ | None | IC50 of 35.9 ± 6.3 nM | |||
| 28323965 | 2017 | MOD-4023 | 275 | CTP fused to hGH | 2 CTP fused | Linear | L | None | Synthetic | Treatment of GHD | Measured at the final randomized dose (following the second dose) | 0.25 mg/kg | 36.1 | Human serum protease | IDS-iSys chemiluminescence assay | Human serum | In Vivo | https://pmc.ncbi.nlm.nih.gov/articles/PMC3159989/, PDB id: 1HGU, https://sci-hub.se/10.1021/acs.molpharmaceut.5b00868 | None | EC50 = 15.8 ± 2.0 ng/ml (Proliferation of BAFB2B2 cells) | |||
| 28068664 | 2017 | scFv57R-ATS | N.A. | Free | (ATS) was fused to the C-terminus of the anti-RV scFv57R | Linear | L | None | scFv57R-ATS fusion protein | Antiviral (against Rabies Virus) | 37o C for 0-72 hours | 0.5 mg/ml | 33.9 | N.A. | ELISA | PBS | In Vitro | None | None | Neutralizing potency (IU/ml) = 2.9 ± 0.5 for polymer | |||
| N.A. | 2017 | SEQ ID NO 84 | 210 | Free | ABP-G148 (Albumin binding protein) conjugation | Linear | L | None | Lipocalin muteins | Pcsk9-Specific Lipocalin Muteins | N.A. | N.A. | 32 | Rats plasma protease | Sandwich ELISA | Rats plasma | In Vivo | None | US 201715445066 A | IC50(nM) = 1.09 without HSA for LDLR binding | |||
| 27558296 | 2016 | Compound 31 | 13 | Palmitic acid conjugation | Free | Linear | L | Nle= Nor-leucine at position 11, Aib = 2-Aminoisobutyric acid at position 12 | Apelin analogs | Inotropic Agent | Time points (0, 0.17, 0.5, 1, 2, 4, 6, 24 and 27 h) | 1 µg/mL | 29 | Wistar rats plasma protease | ESI-MS | Wistar rats plasma | In Vitro | None | None | EC50(nM) = 21.6 ± 4.5 for compound 31 | |||
| 27393654 | 2016 | IFN-PMPC | 165 | Free | poly(2-methacryloyloxyethyl phosphorylcholine) | Linear | L | None | Human derived | Antiproliferative, Immunoregulatory and Antiviral | At desired time points (1, 5, 15, 30 min, 1, 3, 6, 24,48, 72 and 96 h) | 1 mg IFN-α equivalent/kg | 51.6 (T1/2b-Terminal Half Life) | Mice plasma protease | ELISA | Mice plasma | In Vivo | None | None | IC50 = 20.02 pg/mL | |||
| 27364558 | 2016 | Biotinylated SSTN(IGF1R) | 28 | Free | Free | Linear | L | Biotinylation | Mouse derived | Dually Attack MM Tumor Cell Survival And Tumor Angiogenesis | terminally bled at 0, 0.1, 0.3, 1, 3, 6, 12 and 24 hr post-injection | 0.365 mg/kg | 27 | Female BALB/c mice serum | IR scanning using anti-biotin antibody | Female BALB/c mice serum | In Vivo | https://pmc.ncbi.nlm.nih.gov/articles/PMC3651771/ | None | The growth of human CAG, RPMI-8226, KMS-12, U266, MM.1R and the mouse P3X63Ag8 myeloma cells was significantly reduced by a three-day treatment with 30 μM SSTNIGF1R | |||
| 27232339 | 2016 | GLP-1-IgG2σ-Fc | 31 | Free | Human IgG2σ constant heavy-chain linked via a peptide linker (GGGSGGGSGGGS) with human GLP-1 (A8G/G26E/R36G) at C terminal | Linear | L | GLP-1 variant (A8G/G26E/R36G) linked to the human IgG2σ constant heavy-chain by a peptide linker (GGGSGGGSGGGS) | GLP-1 analogs | Antidiabetes | Blood (0.6 mL) was collected from the foreleg vein immediately pre-administration (time 0), and at 2, 4, 8, 12, 48, 72, 96, 192,240, and 288 h after a single subcutaneous injection of GLP-1-IgG2σ-Fc | 0.1 mg/kg | 57.1 ± 4.5 | Cynomolgus monkeys plasma protease | ELISA | Cynomolgus monkeys plasma | In Vivo | PDB id: 5VAI | None | Cells incubated with medium containing 16.8 mM glucose secreted significantly more insulin in the presence of 10 nM (5.2 ± 0.4 ng/mL) and 100 nM (7.3 ± 0.3 ng/mL) GLP-1-IgG2σ-Fc, as compared with control cells (2.5 ± 0.5 ng/mL) | |||
| 27217590 | 2016 | PF1 | 9 | Free | Amidation | Cyclic (C1-C6 Disulfide Linkage) | L | Substitution of the Pro7 to Gly and Leu8 to a Lys appended with a polyethylene glycol space and a palmitoyl group, Palm = Palmitic acid | OT analog | Non–brain-penetrant OT receptor agonist | Serial blood samples were collected from each mouse via the retro-orbital sinus at the following time points postdose: 0.5, 1, 2, 4, 6, and 24 hours | 20 mg/kg | 309 | C57Bl/6J mice plasma protease | LC-MS/MS | C57BL/6J mice plasma | In Vivo | None | None | EC50(nM) = 0.025 (OTR agonist) | |||
| 27166982 | 2016 | ADM analogue 17 | 38 | Tam (6-Carboxytetramethylrhodamine) labeling, Glycine substitution at position 1 | Amidation | Cyclic (Dpr3-E8 Lactam Bridge) | L | K1, Dpr3 = Diaminopropionic acid,E8 substituitions and Pam = Palmitoylation modification at side chain of Lys1 | ADM analogue | Treatment of Cardiovascular Diseases | 37°C | 0.00001 M | 84.6 | Human blood plasma protease | RP-HPLC | Human blood plasma | In Vitro | None | None | EC50 = 13.2 nM for ADM analogue 15 | |||
| 27166982 | 2016 | ADM analogue 20 | 38 | Tam (6-Carboxytetramethylrhodamine) labeling, Glycine substitution at position 1 | Amidation | Cyclic (Dpr3-E8 Lactam Bridge) | L | Nα-Methylation of Lysine at position 33, K1, Dpr3 = Diaminopropionic acid,E8 substituitions and Pam = Palmitoylation modification at side chain of Lys1 | ADM analogue | Treatment of Cardiovascular Diseases | 37°C | 0.00001 M | 126.2 | Human blood plasma protease | RP-HPLC | Human blood plasma | In Vitro | None | None | EC50 = 13.2 nM for ADM analogue 15 | |||
| 27155328 | 2016 | I-3 | 38 | Free | Amidation | Linear | L | X3(Fatty acid structure given in paper) linked with Ser11 | Exendin-4 analogs | Antidiabetes | At 0, 1, 2, 4, 6, 8, 12, 24, 36, 48 and 72 h time points, 100 lL mixture was aliquoted | 1000 ng/mL | 35.6 | SD rats plasma protease | LC-MS/MS | SD rats plasma | In Vitro | None | None | EC50(pM) =38.47 ± 9.86 | |||
| 26905040 | 2016 | EX4-2K | 40 | Free | PEG(2KDa) linked with Ex-4 through Mal (Maleimide) | Linear | L | None | Exendin-4 analogs | Antidiabetes | 37 °C | 200 μg/mL | 69.2 | Mice plasma protease | RP-HPLC | CLP-induced septic mice plasma | In Vitro | None | None | WT-EX4 bound to GLP-1R, with a dissociation constant of Kd(app) ≈ 0.142 nM | |||
| 26905040 | 2016 | EX4-5K | 40 | Free | PEG(5KDa) linked with Ex-4 through Mal (Maleimide) | Linear | L | None | Exendin-4 analogs | Antidiabetes | 37 °C | 200 μg/mL | 62.8 | Mice plasma protease | RP-HPLC | CLP-induced septic mice plasma | In Vitro | None | None | WT-EX4 bound to GLP-1R, with a dissociation constant of Kd(app) ≈ 0.142 nM | |||
| 26905040 | 2016 | EX4-20K | 40 | Free | PEG(20KDa) linked with Ex-4 through Mal (Maleimide) | Linear | L | None | Exendin-4 analogs | Antidiabetes | 37 °C | 200 μg/mL | 69.7 | Mice plasma protease | RP-HPLC | CLP-induced septic mice plasma | In Vitro | None | None | WT-EX4 bound to GLP-1R, with a dissociation constant of Kd(app) ≈ 0.142 nM | |||
| 26905040 | 2016 | EX4-50K | 40 | Free | (PEG(50KDa))3 linked with Ex-4 through Mal (Maleimide) | Linear | L | None | Exendin-4 analogs | Antisepsis | 37 °C | 200 μg/mL | 234.2 | Mice plasma protease | RP-HPLC | CLP-induced septic mice plasma | In Vitro | None | None | A dissociation constant of Kd(app) ≈ 0.159 nM was obtained for the interaction between GLP-1R and EX4-50 | |||
| 26877782 | 2016 | Abextide | 40 | Free | tEB (Truncated Evans blue) dye linked via Maleimide | Linear | L | Cys addition at C terminal of Ex4 | Exendin-4 analogs | Antidiabetes | At predetermined times (0, 1, 2, 4, 6, 8, 12, 24, 48, 72, 96 h), blood samples were collected from tail vein of each animal | 25 nmol/kg | 36.28 ± 7.01 | DB/DB mice plasma protease | Exendin-4 EIA | DB/DB mice plasma | In Vivo | None | None | IC50 = 0.18 ± 0.06 nM | |||
| 28989813 | 2016 | 54.6 kDa EG9 | 43 | Free | AEBMP: N-(2-(2-(2-(2-aminoacetamido)acet-amido)acetamido) ethyl)-2-bromo-2-methylpropanamide, OEGMA(54.6KDa) | Linear | L | Fluorescently labeled with Alexa Fluor | Exendin-4 analogs | Antidiabetes | 10 μL of blood samples were collected from the tail vein into 100 μL of a heparin solution (1kU/ml in PBS, Sigma Aldrich) at 40 s, 40 min, 2.5 h, 4.5 h, 8 h, 24 h, 48 h, 72 h, 96 h and 120 h after injection | 75 nmol/kg | 42.4 ± 2.9 (T1/2 Elimination Half Life) | Mice plasma protease | Fluorescence assay | Mice plasma | In Vivo | None | None | EC50(nM) = 1.91 ± 0.35 | |||
| 28989813 | 2016 | 55.6 kDa EG3 | 43 | Free | AEBMP: N-(2-(2-(2-(2-aminoacetamido)acet-amido)acetamido) ethyl)-2-bromo-2-methylpropanamide, OEGMA(55.6KDa) | Linear | L | Fluorescently labeled with Alexa Fluor | Exendin-4 analogs | Antidiabetes | 10 μL of blood samples were collected from the tail vein into 100 μL of a heparin solution (1kU/ml in PBS, Sigma Aldrich) at 40 s, 40 min, 2.5 h, 4.5 h, 8 h, 24 h, 48 h, 72 h, 96 h and 120 h after injection | 75 nmol/kg | 61.2 ± 5.0 (T1/2 Elimination Half Life) | Mice plasma protease | Fluorescence assay | Mice plasma | In Vivo | None | None | EC50(nM) = 4.17 ± 0.13 | |||
| 28989813 | 2016 | 71.6 kDa EG3 | 43 | Free | AEBMP: N-(2-(2-(2-(2-aminoacetamido)acet-amido)acetamido) ethyl)-2-bromo-2-methylpropanamide, OEGMA(71.6KDa) | Linear | L | Fluorescently labeled with Alexa Fluor | Exendin-4 analogs | Antidiabetes | 10 μL of blood samples were collected from the tail vein into 100 μL of a heparin solution (1kU/ml in PBS, Sigma Aldrich) at 40 s, 40 min, 2.5 h, 4.5 h, 8 h, 24 h, 48 h, 72 h, 96 h and 120 h after injection | 75 nmol/kg | 61.5 ± 3.2 (T1/2 Elimination Half Life) | Mice plasma protease | Fluorescence assay | Mice plasma | In Vivo | None | None | EC50(nM) = 5.11 ± 0.23 | |||
| 26507721 | 2016 | Dulaglutide | 275 | Free | IgG4 Fc fused at C terminal using GS linker | Linear | L | None | GLP-1 analogs | Antidiabetes | 4 to 6 weeks | 0.75 mg | 5.5 (GM) | Human plasma protease | RIA | Human plasma after multiple doses of dulaglutide once weekly, ranging from 4 to 6 weeks | In Vivo | DB id: DB09045 | None | N.A. | |||
| 26507721 | 2016 | Dulaglutide | 275 | Free | IgG4 Fc fused at C terminal using GS linker | Linear | L | None | GLP-1 analogs | Antidiabetes | 4 to 6 weeks | 1.5 mg | 4.7 (GM) | Human plasma protease | RIA | Human plasma after multiple doses of dulaglutide once weekly, ranging from 4 to 6 weeks | In Vivo | DB id: DB09045 | None | N.A. | |||
| 26381279 | 2016 | 3H-RD2 | 12 | 3H labelled | Amidation | Linear | D | All D-amino acid substituitions | D3 derivative | Therapeutically active against toxic Β-Amyloid oligomers | Time points: 3 min, 5 min, 10 min, 15 min, 30 min, 1 h, 4 h, 1 d, 2 d, 7 d, 28 d | 3.3 mg/kg | 59 (Terminal Half Life) | Mouse plasma protease | TLC | Mouse plasma | In Vivo | DB id: DB09045 | None | Fraction unbound to AGP (fu) at a RD2 concentration of 0.23 μM: 12.3% | |||
| 26381279 | 2016 | 3H-RD2 | 12 | 3H labelled | Amidation | Linear | D | All D-amino acid substituitions | D3 derivative | Therapeutically active against toxic Β-Amyloid oligomers | Time points: 10 min, 20 min, 30 min, 1 h, 2 h, 4 h, 6 h, 1 d, 2 d, 7 d, 28 d | 10 mg/kg | 62 (Terminal Half Life) | Mouse plasma protease | TLC | Mouse plasma | In Vivo | DB id: DB09045 | None | Fraction unbound to AGP (fu) at a RD2 concentration of 0.23 μM: 12.3% | |||
| 26381279 | 2016 | 3H-RD2 | 12 | 3H labelled | Amidation | Linear | D | All D-amino acid substituitions | D3 derivative | Therapeutically active against toxic Β-Amyloid oligomers | Time points: 10 min, 20 min, 30 min, 1 h, 2 h, 4 h, 6 h, 1 d, 2 d, 7 d, 28 d | 10 mg/kg | 60 (Terminal Half Life) | Mouse plasma protease | TLC | Mouse plasma | In Vivo | DB id: DB09045 | None | Fraction unbound to AGP (fu) at a RD2 concentration of 0.23 μM: 12.3% | |||
| 26381279 | 2016 | 3H-RD2 | 12 | 3H labelled | Amidation | Linear | D | All D-amino acid substituitions | D3 derivative | Therapeutically active against toxic Β-Amyloid oligomers | Time points: 30 min, 1 h, 2 h, 4 h, 6 h, 8 h, 18 h, 1 d, 2 d, 3 d, 7 d, 28 d | 10 mg/kg | 58 (Terminal Half Life) | Mouse plasma protease | TLC | Mouse plasma | In Vivo | DB id: DB09045 | None | Fraction unbound to AGP (fu) at a RD2 concentration of 0.23 μM: 12.3% | |||
| 26381279 | 2016 | 3H-RD2 | 12 | 3H labelled | Amidation | Linear | D | All D-amino acid substituitions | D3 derivative | Therapeutically active against toxic Β-Amyloid oligomers | Time points: 3 min, 5 min, 10 min, 15 min, 30 min, 1 h, 4 h, 1 d, 2 d, 7 d, 28 d | 3.3 mg/kg | 60 (Terminal Half Life) | Mouse brain homogenate protease | TLC | Mouse brain homogenate | In Vivo | DB id: DB09045 | None | Fraction unbound to AGP (fu) at a RD2 concentration of 0.23 μM: 12.3% | |||
| 26381279 | 2016 | 3H-RD2 | 12 | 3H labelled | Amidation | Linear | D | All D-amino acid substituitions | D3 derivative | Therapeutically active against toxic Β-Amyloid oligomers | Time points: 10 min, 20 min, 30 min, 1 h, 2 h, 4 h, 6 h, 1 d, 2 d, 7 d, 28 d | 10 mg/kg | 61 (Terminal Half Life) | Mouse brain homogenate protease | TLC | Mouse brain homogenate | In Vivo | DB id: DB09045 | None | Fraction unbound to AGP (fu) at a RD2 concentration of 0.23 μM: 12.3% | |||
| 26381279 | 2016 | 3H-RD2 | 12 | 3H labelled | Amidation | Linear | D | All D-amino acid substituitions | D3 derivative | Therapeutically active against toxic Β-Amyloid oligomers | Time points: 10 min, 20 min, 30 min, 1 h, 2 h, 4 h, 6 h, 1 d, 2 d, 7 d, 28 d | 10 mg/kg | 94 (Terminal Half Life) | Mouse brain homogenate protease | TLC | Mouse brain homogenate | In Vivo | DB id: DB09045 | None | Fraction unbound to AGP (fu) at a RD2 concentration of 0.23 μM: 12.3% | |||
| 26381279 | 2016 | 3H-RD2 | 12 | 3H labelled | Amidation | Linear | D | All D-amino acid substituitions | D3 derivative | Therapeutically active against toxic Β-Amyloid oligomers | Time points: 30 min, 1 h, 2 h, 4 h, 6 h, 8 h, 18 h, 1 d, 2 d, 3 d, 7 d, 28 d | 10 mg/kg | 73 (Terminal Half Life) | Mouse brain homogenate protease | TLC | Mouse brain homogenate | In Vivo | DB id: DB09045 | None | Fraction unbound to AGP (fu) at a RD2 concentration of 0.23 μM: 12.3% |