AptBacterialDB

Year : 2026

Total records found: 17

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1934 415331982026Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureusCA 7.1ACACTAGATCAGTCACAG-GATTAAGGATCGTTGTTGGGTGGTTTCCGTAATTACTATC-GACTTGACTCAGACATCT765'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3'ssDNAStaphylococcus aureus (S. aureus)Clumping factor A (ClfA)Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection.N/A11N/AN/ADetectionNi-NTA affinity SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1935 415331982026Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureusCA 15.1ACACTAGATCAGTCACAG-GGTTGCTCAGGAGAAGGGAACGTGGGTGGTGGCGCGGACG-GACTTGACTCAGACATCT765'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3'ssDNAStaphylococcus aureus (S. aureus)Clumping factor A (ClfA)Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection.N/A11N/AN/ADetectionNi-NTA affinity SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1936 415331982026Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureusCA 3.1ACACTAGATCAGTCACAG-ACGGGGAGAGGGTCATCTCTGGTTTCGGGGTGCTAATTCT-GACTTGACTCAGACATCT765'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3'ssDNAStaphylococcus aureus (S. aureus)Clumping factor A (ClfA)Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection.N/A11N/AN/ADetectionNi-NTA affinity SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1937 415331982026Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureusCA 8.1ACACTAGATCAGTCACAG-CCCCGACCTGTACACGTACTACCCGATGACATTTGGTGTT-GACTTGACTCAGACATCT765'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3'ssDNAStaphylococcus aureus (S. aureus)Clumping factor A (ClfA)Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection.N/A11N/AN/ADetectionNi-NTA affinity SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1938 415331982026Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureusCA 13.1ACACTAGATCAGTCACAG-TGGACGCGGCGGGCCGGATTAAGTTGAGGAGAGGGGGGTG-GACTTGACTCAGACATCT765'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3'ssDNAStaphylococcus aureus (S. aureus)Clumping factor A (ClfA)Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection.N/A11N/AN/ADetectionNi-NTA affinity SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1939 415331982026Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureusCA 16.1ACACTAGATCAGTCACAG-AGTATATATGGATTCCGCAACGTACGCAGGGGGTGTCGCC-GACTTGACTCAGACATCT765'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3'ssDNAStaphylococcus aureus (S. aureus)Clumping factor A (ClfA)Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection.N/A11N/AN/ADetectionNi-NTA affinity SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1940 415331982026Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureusCA 14.1ACACTAGATCAGTCACAG-CAGAGAGGGGCGGCGAGGGACAAAGGAGGGTAGGTGTGCC-GACTTGACTCAGACATCT765'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3'ssDNAStaphylococcus aureus (S. aureus)Clumping factor A (ClfA)Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection.N/A11N/AN/ADetectionNi-NTA affinity SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1941 415331982026Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureusCA 12.1ACACTAGATCAGTCACAG-ATCACAGCGGAGGTTTAACGTGTGGCGGGTGTGGGGACATG-GACTTGACTCAGACATCT775'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3'ssDNAStaphylococcus aureus (S. aureus)Clumping factor A (ClfA)Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection.N/A11N/AN/ADetectionNi-NTA affinity SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1942 415331982026Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureusCA 11.1ACACTAGATCAGTCACAG-GAGCAACAGTCTCGCCTTCGTTACTGCGCGCGGGACGGGG-GACTTGACTCAGACATCT765'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3'ssDNAStaphylococcus aureus (S. aureus)Clumping factor A (ClfA)Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection.CA 11.1 exhibited S. aureus binding in a linear range of 10(3) to 10(8) CFU/mL and a limit of detection (LOD) of 10(3) CFU/mL.11Bead-based Binding Assay263.8 ± 78 nMDetectionNi-NTA affinity SELEX5'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_1943 415331982026Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureusCA 17.1ACACTAGATCAGTCACAG-AAGTGGAATCAAGCATGGGTATTTTAAGCATCGTATCTCG-GACTTGACTCAGACATCT765'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3'ssDNAStaphylococcus aureus (S. aureus)Clumping factor A (ClfA)Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection.N/A11N/AN/ADetectionNi-NTA affinity SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1944 415331982026Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureusCA 5.1ACACTAGATCAGTCACAG-TGTTTCACGGGGGGGAGGGTAACGGAAGCTAATGGTCTCG-GACTTGACTCAGACATCT765'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3'ssDNAStaphylococcus aureus (S. aureus)Clumping factor A (ClfA)Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection.N/A11N/AN/ADetectionNi-NTA affinity SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1945 413440102026SERS-based Aptasensor using Au NSs@Ag NPs/magnetic graphene oxide assemblies for simultaneous detection of Escherichia coli and Staphylococcus aureusApt1 & Apt3ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTATTTTTTTTTT81N/AssDNAEscherichia Coli (E. Coli)Whole cellDeveloped a SERS aptasensor based on aptamer-magnetic graphene oxide (MGO) and dual-functional Au NSs@Ag NPs probes for simultaneous detection of E. coli and S. aureus.The SERS intensity shows a good linear relationship over a range of 50 to 10(6) CFU/mL, with a detection limit of 16 CFU/mL for E. coli.N/AN/AN/ABiosensorN/A5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4)N/AN/AN/AN/AN/A
ABdb_1946 413440102026SERS-based Aptasensor using Au NSs@Ag NPs/magnetic graphene oxide assemblies for simultaneous detection of Escherichia coli and Staphylococcus aureusApt2 & Apt4TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACTTTTTTTTT71N/AssDNAStaphylococcus aureus (S. aureus)Whole cellDeveloped a SERS aptasensor based on aptamer-magnetic graphene oxide (MGO) and dual-functional Au NSs@Ag NPs probes for simultaneous detection of E. coli and S. aureus.The SERS intensity shows a good linear relationship over a range of 50 to 10(6) CFU/mL, with a detection limit of 20 CFU/mL for S. aureus.N/AN/AN/ABiosensorN/A5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4)N/AN/AN/AN/AN/A
ABdb_1947 412897762026Improving electrochemical aptasensor sensitivity for Bacillus cereus spore detection in food safety applicationsApt1CATCCGTCACACCTGCTCGGTGCAGACCCATAGGGGGGGCGTGCGGATGTGCGGAGTAGGGTGTTCGCTCCCGTATC77N/AssDNABacillus Cereus strain INRA-SV-S51B. cereus sporesDeveloped an electrochemical aptasensor for the detection of B. cereus spores.An aptasensor based on three aptamers exhibited a wide dynamic range (10(2)–10(7) CFU/mL) and a low limit of detection (∼1 CFU/mL) using only 15 μL of sample.N/AN/AN/ABiosensorN/A5′-HO(CH2)6SS(CH2)6(T)5 group, or 5'-TexasRed LabeledN/AN/AN/AN/AN/A
ABdb_1948 412897762026Improving electrochemical aptasensor sensitivity for Bacillus cereus spore detection in food safety applicationsApt2CATCCGTCACACCTGCTCCCCAATGAAGCGAGATGGACGCCTAGCACCCCCCGCGTCCGGTGTTGGCTCCCGTATC76N/AssDNABacillus Cereus strain INRA-SV-S51B. cereus sporesDeveloped an electrochemical aptasensor for the detection of B. cereus spores.An aptasensor based on three aptamers exhibited a wide dynamic range (10(2)–10(7) CFU/mL) and a low limit of detection (∼1 CFU/mL) using only 15 μL of sample.N/AN/AN/ABiosensorN/A5′-HO(CH2)6SS(CH2)6(T)5 group, or 5'-TexasRed LabeledN/AN/AN/AN/AN/A
ABdb_1949 412897762026Improving electrochemical aptasensor sensitivity for Bacillus cereus spore detection in food safety applicationsBAS6ATCCGTCACACCTGCTCTGCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGATGGTGTTGGCTCCCGTAT71N/AssDNABacillus Cereus strain INRA-SV-S51B. cereus sporesDeveloped an electrochemical aptasensor for the detection of B. cereus spores.An aptasensor based on three aptamers exhibited a wide dynamic range (10(2)–10(7) CFU/mL) and a low limit of detection (∼1 CFU/mL) using only 15 μL of sample.N/AN/AN/ABiosensorN/A5′-HO(CH2)6SS(CH2)6(T)5 group, or 5'-TexasRed LabeledN/AN/AN/AN/AN/A
ABdb_1950 411351622026Silver-decorated nanobeads for high-performance and flexible analysis of Shigella dysenteriae utilizing a paper-based aptasensorAptamerATAGGAGTCACGACGACCAGAACGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGCAGGGATTAGTCAAGAGGTAGACGCACATA86N/AssDNAShigella DysenteriaeWhole cellDeveloped an Ag/MBs-modified paper-based aptasensor to detect S. dysenteriae.MB-based assays achieve broad linearity (DPV = 10(2)–10(8) CFU/mL, EIS = 10(1)–10(9) CFU/mL) and high sensitivity (DPV = 90 CFU/mL, EIS = 8.09 CFU/mL).N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/ALong stability of up to 28 days at 4°C.N/AN/AN/A