Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 61
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1873 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 3 (Ap3) | NNNNNNNNNNNNNNNNNNNNNGGGGGCTTTCAAGGGCGCGACGAAGCTGTTTTATTCTC | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | Achieved a detection limit of 0.1 ag/mL EC proteins (equivalent to 3 protein particles per mL) within 120 min from the plasma sample. | 15 | Isothermal Titration Calorimetry (ITC) | 8.30 x 10-7 M | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1874 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 1 (Ap1) | GACGTTTTGCAAGTGCGGCTACTACAAGCGAAGTTCCATCATTTTAGAGTCATAAACGC | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1875 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 6 (Ap6) | CCGCCTGGAAGGCATTTCGCCGGGAAGACCCACGTCACTCCTCCCCTGAACTTCGGTTC | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1876 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 2 (Ap2) | TATACATTGATTTATCGGACCACTGCAGTACCACGCAGGATGGACGGCCATCGTTAATA | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1877 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 4 (Ap4) | TAGGATTCGTTTATTCGTGGGGCTGTAGTTCCGATAAAACCGCCAAGGGATCGTTGCCT | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1878 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 5 (Ap5) | ATTAGATGTAAAACGCCACGGGTAGCAGTTAAAGTCGTATTTATAGGCACAACGAAGAT | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1879 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 7 (Ap7) | CAATTAGACAGGCTCTAAGCTTTGGACCCAGCGTAGAAAGTTTGTTATTTCTTCGGGCT | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1880 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 8 (Ap8) | ATAAGCTTTTTAAGGCAAGGACGCGGCCCGGTACTTGCGTTGGAGGAATCTTAAGTTAT | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1881 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 9 (Ap9) | CATTTATAACTACGATTGTGGTCACATTCCGTGGATGGAATCACTTCTCAGGTGCCGAG | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1882 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 10 (Ap10) | TGTTTACACATATTCTTGCGCATTACTTGCTTTGGCATTATCTGTATCCCCCTCAGCGG | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1883 | 41431270 | 2025 | Bioimaging with fluorescent nucleic-acid aptamers for the specific detection and quantification of Pseudomonas aeruginosa alone and in heterogeneous bacterial populations | F23 | ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT | 96 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15692) | Whole cell | Develop a fluorescent aptamer for detecting Pseudomonas aeruginosa. | 73.79% of live P. aeruginosa cells (3102/4204) were labeled by the Cy5‐F23 aptamer, compared to only 0.06% of live S. aureus (4/6767). | 15 | Flow Cytometry | 17.27 ± 5.00 nM | Imaging | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | The aptamer remains highly stable for 72 hours. | N/A | N/A | N/A |
| ABdb_1884 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-6 | GCTGCAATACTCATGGACAGCACGGCACGGGCTGTCGATCTCGAGGGAAACGGCACATGTGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Outer membrane protein BamA (β-barrel assembly machinery A) | Identify aptamers against Brucella and conjugate them to liposomes for selective recognition and significantly reduced bacterial invasion of host cells. | WS-6 significantly reduced Brucella invasion, as evidenced by a decrease in qPCR Ct from 22.34 to 20.64 (P < 0.05), confirming a reduced intracellular bacterial load. | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 16.23 ± 5.84 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | The aptamer demonstrated stable binding to the Brucella S2 vaccine across a temperature range of 16–50°C, with optimal binding observed between 16°C and 50°C and under neutral conditions (pH 7.6) in 2h. | Best Candidate | N/A | N/A |
| ABdb_1885 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-26 | GCTGCAATACTCATGGACAGCGGAACGCTGTCTCCTCATTCAATCTAGGAGTCTGCGTGAGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 20.33 ± 8.12 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1886 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-17 | GCTGCAATACTCATGGACAGGACAACGTCCTGTACCAGCGCTACGCCAGATCAGTTTTAGGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 17.11 ± 6.35 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1887 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-32 | GCTGCAATACTCATGGACAGGGGACTCAGGTCCCCGGGAGCGCAATGGTGGGGTTTTAATGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 13.08 ± 2.97 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1888 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-44 | GCTGCAATACTCATGGACAGGGACCTGTCCCTGGCCTCTTAGGGTAAAATTTTGCCACAAGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 15.03 ± 4.2 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1889 | 39894103 | 2025 | Introduce a novel, extremely sensitive aptamer against staphylococcal enterotoxin type D | Aptamer 1 | CCTAACCGATATCACACTCAC-GGGTGCAGCCCGGAGCGGCTTGCATGATTGGGTTGGTGGG-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-N40-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin D (SED) | Isolate high-affinity ssDNA aptamers with specificity for SED. | The limit of detection (LOD) for SED was determined to be 45 nM. | 10 | Surface Plasmon Resonance (SPR) and Enzyme-Linked Apta-Sorbent Assay (ELASA) | 4.4 ± 2.26 nM (by SPR) and 13.43 nM (by ELASA) | Diagnostic | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1890 | 40308970 | 2025 | Aptamer-functionalized graphene quantum dots combined with artificial intelligence detect bacteria for urinary tract infections | Aptamer | CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG | 45 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Develop an aptamer-functionalized graphene quantum dots integrated with an artificial intelligence detection system (AG-AI detection system) for the detection of E. coli. | Exhibits a wide linearity (10(3)-10(9) CFU/mL) and a low detection limit (3.38×10(2) CFU/mL). | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1891 | 40855524 | 2025 | Inhibition of Enterotoxigenic Escherichia coli adhesion via aptamers prevents infection in IPEC-J2 cells | K88-Apt A04 | GGGAGCTCAGAATAAACGCTCAACCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTGTTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | K88 fimbriae protein | An aptamer was identified to effectively inhibit the adhesion of ETEC K88 to intestinal epithelial cell IPEC-J2 and reduce ETEC K88-induced cytotoxicity in IPEC-J2 cells in vitro. | K88-Apt A04 may more effectively displace ETEC K88 and induce less cytotoxicity than K88-Apt 37, as it resulted in lower TNF-α expression. | N/A | N/A | 34.51 ± 9.15 nM | Therapeutics | N/A | 5'-FAM Labeled | K88-Apt A04 indicated the lowest cytotoxicity (5.18%) at 100 nM | N/A | Best Candidate | N/A | N/A |
| ABdb_1892 | 40855524 | 2025 | Inhibition of Enterotoxigenic Escherichia coli adhesion via aptamers prevents infection in IPEC-J2 cells | K88-Apt 37 | GGAGACCGTACCATCTGTTCGTGGAAGCGCTTTGCTCGTCCATTAGCCTTGTGCTCGTGC | 60 | N/A | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | An aptamer was identified to effectively inhibit the adhesion of ETEC K88 to intestinal epithelial cell IPEC-J2 and reduce ETEC K88-induced cytotoxicity in IPEC-J2 cells in vitro. | K88-Apt A04 may more effectively displace ETEC K88 and induce less cytotoxicity than K88-Apt 37, as it resulted in lower TNF-α expression. | N/A | N/A | 21.68 ± 4.65 nM | Therapeutics | N/A | 5'-FAM Labeled | K88-Apt 37 revealed the lowest cytotoxicity (8.77%) at 50 nM. | N/A | N/A | N/A | N/A |
| ABdb_1893 | 41245639 | 2025 | Simultaneous and sensitive detection of Mycobacterium tuberculosis and SARS-CoV-2 antigens employing an electrochemical impedance spectroscopy aptasensor | MPT64 aptamer sequence (17) | GTCAACAGTCCAGTTGGGAGGTCGCTTATAGCTGCTTGTC | 40 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop an EIS-based aptasensor fabricated to detect MPT64 and S-glycoprotein simultaneously, employing a dual-platform approach on a screen-printed gold electrode (SPGE). | Achieved detection limits of 0.053 pg/mL in buffer and in human serum of 0.085 pg/mL with a linear range of 0.01 pg/mL to 10 pg/mL in both buffer and human serum. | N/A | N/A | 8.92 nM | Biosensor | N/A | 5'-Thiolated (HS(CH2)6-(CH2CH2O)6-TTTTT) | N/A | The aptasensor maintained good storage stability for up to 22 days. | N/A | N/A | N/A |
| ABdb_1894 | 39793372 | 2025 | Aptamer-molecularly imprinted polymer sensors for the detection of bacteria in water | LPS Aptamer | TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCA | 45 | N/A | ssDNA | Escherichia Coli (E. Coli) DH5α | Lipopolysaccharide (LPS) | Developed an electrochemical sensor based on aptamer-molecularly imprinted polymer (Apta-MIP) for the multiplexed detection of Staphylococcus aureus and Escherichia coli. | Can detect E. coli with a limit of detection of 2 CFU/mL and exhibited a broad dynamic range from 1 CFU/mL to 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1895 | 39793372 | 2025 | Aptamer-molecularly imprinted polymer sensors for the detection of bacteria in water | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) strain SH1000 | Whole cell | Developed an electrochemical sensor based on aptamer-molecularly imprinted polymer (Apta-MIP) for the multiplexed detection of Staphylococcus aureus and Escherichia coli. | Can detect S. aureus with a limit of detection of 4 CFU/mL and exhibited a broad dynamic range from 1 CFU/mL to 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1896 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S8 | CGTACGGTCGACGCTAGC-ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1897 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S10 | CGTACGGTCGACGCTAGC-ACCAGCCATAGTCACATCAAAACTAACTCACATTC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1898 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S12 | CGTACGGTCGACGCTAGC-CCCATACTCATCACCATTCACATCACTCACCTAGC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1899 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S1 | GGATCCGAGCTCCACGTG-GCTAGGTGAGTGATGTGAATGGTGATGAGTATGGG-GCTAGCGTCGACCGTACG | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S1, the Ru-modified oligonucleotide, bound S. pneumoniae R6 with slightly lower affinity than S9. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 125 ± 91 nM | Detection | SELEX and Mod-SELEX | T=dURu(bpy)TP1, 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1900 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S9 | ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S9 bound better to the bacterial target than the modified sequence S1. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 118 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1901 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S11 | ACCAGCCATAGTCACATCAAAACTAACTCACATTC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S11 exhibited a lower propensity at binding to the bacterial target. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 541 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1902 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S13 | CCCATACTCATCACCATTCACATCACTCACCTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1903 | 41339596 | 2025 | Self-reduced Pd nanoparticles on NiMn-LDHs with superior catalytic activity for signal amplification in electrochemical aptasensing of Mycobacterium tuberculosis ESAT-6 antigen | Apt | GGGAGCTCAGAATAAACGCTCAACCTCCCTGGGTCACCATAGACTCCATCTAAGATGCTTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT-6 (6-kDa early secretory antigenic target) | Developed an electrochemical aptasensor using NiMn-layered double hydroxides@palladium nanoparticles (NiMn-LDHs@PdNPs) for detecting the ESAT-6 antigen in human serum. | The aptasensor exhibited a wide linear detection range of 75 pg/mL to 10 ng/mL with a low limit of detection (LOD) of 0.629 pg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Biotinylated | N/A | Aptasensor was stored at 4°C for and after 30 days, the current remained approximately 80% of the initial value. | N/A | N/A | N/A |
| ABdb_1904 | 40517569 | 2025 | Ultrasensitive electrochemical aptasensor for Pseudomonas aeruginosa detection using N-doped MWCNTs/AgNPs nanocomposite | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Developed an electrochemical P.A. biosensor based on N-MWCNTs/AgNPs-10/Apt for the detection of P. aeruginosa. | Exhibited a wide linear detection range from 10(-1) to 10(6) CFU/mL, and the limit of detection is 0.0798 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1905 | 41123678 | 2025 | Portable AI-driven electrochemical aptasensor for real-time Staphylococcus aureus detection in food and beverages | IsdA-specific aptamer | GCGCACGCGUGUGUAGUACACACGAUCGCGCGCACAAUAU | 40 | N/A | ssRNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Iron-regulated Surface Determinant Protein A (IsdA) | Developed a portable electrochemical aptasensor integrated with machine learning using SPCE/AuNPs for the detection of S. aureus in food and beverage samples. | The lowest detection limit for S. aureus was 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1906 | 40947925 | 2025 | Smartphone-Based Fluorescence/Colorimetric Dual-Mode Aptasensor for the Detection of Salmonella Using Multivalent Aptamer and CHA Amplification | Aptamer | GTGAGAGTGGGTCATCGAAAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTCTGATGTCGGTAGT | 82 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a dual-mode portable fluorescent/colorimetric aptasensor, leveraging multivalent aptamer competitive assays and catalytic hairpin assembly (CHA) for the detection of Salmonella. | Enables the quantitative detection of Salmonella within a linear range of 10 to 10(7) CFU/mL, with detection limits of 28 CFU/mL for colorimetric detection and 10 CFU/mL for fluorescent detection. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1907 | 41149287 | 2025 | Real-Time and Selective Detection of Pseudomonas aeruginosa in Beef Samples Using a g-C3N4-Doped Multimetallic Perovskite-Based Electrochemical Aptasensor | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Developed an electrochemical aptasensor based on aptamer functionalized FeCoCuNiO-g-C3N4 nanocomposite for the detection of P. aeruginosa in food samples. | Exhibited a low detection limit of 3.03 CFU/mL and over a range of 1 × 10(1)–1 × 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1908 | 40801776 | 2025 | Ultrasensitive Aptamer-Based Metal-Organic Framework-on-Metal-Organic Framework Platform for Clinical Detection of KPC-2 Klebsiella pneumoniae and Multidrug-Resistant Acinetobacter baumannii | KPC-2 KP aptamer | GGCAGGACACCGTAACGGGTATGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTGCTGC | 60 | N/A | ssDNA | Klebsiella Pneumoniae carbapenemase 2-expressing K. Pneumoniae (KPC-2 KP) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Developed a dual nanozyme-powered colorimetric aptasensor leveraging a cascade amplification mechanism, a metal-organic framework (MOF)-on-MOF nanostructure with peroxidase-like activity for detection of KPC-2 K. pneumoniae and MDR-AB. | The system achieves selective bacterial capture within 40 min, quantifying 10–10(8) CFU/mL with a detection limit of 7 CFU/mL for KPC-2 KP. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1909 | 40801776 | 2025 | Ultrasensitive Aptamer-Based Metal-Organic Framework-on-Metal-Organic Framework Platform for Clinical Detection of KPC-2 Klebsiella pneumoniae and Multidrug-Resistant Acinetobacter baumannii | MDR-AB aptamer | CAGGGGACGCACCAAGGTTTTGTTTTTTCTTTGCTTCTTTTTGCTTTTTTTTCCATGACCCGCGTGCTGCGTGA | 74 | N/A | ssDNA | Multidrug-resistant (MDR) Acinetobacter Baumannii | Whole cell | Developed a dual nanozyme-powered colorimetric aptasensor leveraging a cascade amplification mechanism, a metal-organic framework (MOF)-on-MOF nanostructure with peroxidase-like activity for detection of KPC-2 K. pneumoniae and MDR-AB. | The system achieves selective bacterial capture within 40 min, quantifying 10–10(8) CFU/mL with a detection limit of 6 CFU/mL for MDR-AB. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1910 | 40931301 | 2025 | A novel fluorescent aptasensor using magnetic silica nanospheres and Ag@MOF nanocomposites for extraction and detection of Salmonella Typhimurium in eggs | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGCATTATGACAG | 39 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (PTCC 1709) | Whole cell | Developed a fluorescent platform based on an aptamer-Ag@MOF and Fe3O4@KCC‐1 probes for the detection of S. Typhimurium in eggs. | Achieved a linear detection range of 7.5 to 7.5 × 10⁶ CFU/mL, a detection limit of 4.61 CFU/mL, and a total detection time of 90 min. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1911 | 40839054 | 2025 | SERS-based aptasensor for culture-free detection of Escherichia coli in urinary tract infection diagnosis | Aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Developed a SERS-based aptasensor for the detection of E. coli. | Demonstrated a detection limit of 5.9 × 10(3) CFU/mL, which is well below the UTI cutoff value. | N/A | N/A | N/A | Biosensor | N/A | 3'-BHQ2 | N/A | N/A | N/A | N/A | N/A |
| ABdb_1912 | 40437283 | 2025 | Target-triggered hybrid chain amplified fluorescence aptasensor based on label-free dye and MnO2 nanosheets system for Escherichia coli detection | AwI | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGATCCATGCTGAGGTGGTCATAGCTGATCCTACCTGTACAAATCGTCTTGAT | 86 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Developed a label-free fluorescent detection system leveraging target-triggered hybridization chain reaction (HCR) amplification for E. coli detection. | Exhibited a detection limit of 17 CFU/mL and a broad dynamic range from 5.0 × 10(1) ~ 5.0 × 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1913 | 40187870 | 2025 | 3D DNA walkers integrated with self-reporting MOFs: Pioneering ratiometric electrochemical sensing for Staphylococcus aureus | S. aureus aptamer (Apt) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a ratiometric electrochemical aptasensor utilizing a magnetic 3D DNA walking machine and self-assembly of MOF for the sensitive detection of S. aureus. | Demonstrates a detection range from 10 to 2 × 10(5) CFU/mL and achieves a low LOD of 2.3 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | After a duration of seven days, the ratio value maintained 91.89% of its initial intensity. | N/A | N/A | N/A |
| ABdb_1914 | 40335784 | 2025 | A novel strategy for ultrasensitive detection and effective inactivation of Staphylococcus aureus based on Fe3O4-QCS-PEI-Cu-aptamer and ladder-branch HCR | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an integrated strategy based on Fe3O4-quaternary ammonium chitosan-polyetherimide-Cu-aptamer (Fe3O4-QCS-PEI-Cu-aptamer) and ladder-branch hybridization chain reaction (HCR) for the detection and inactivation of S. aureus. | The sensor demonstrated a limit of detection (LOD) of 3 CFU/mL for S. aureus and, under near-infrared (NIR) irradiation, achieved an antimicrobial efficiency of 99.946%. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | 3'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1915 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg1 | TGACTGACGACGACTC-AGTGGAGTATCGCCTTGCCGACCCGGGTGTCTACGATCAGTGAGTGGTAGT-GACTGCTCGAGCTG | 81 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1916 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg2 | TGACTGACGACGACTC-TGGAGCTCGGGTATTCTCGTCAGACCCTCCTGAGTTGATTTTAGCAACCG-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1917 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg3 | TGACTGACGACGACTC-CGGCGAGTAACGACTATGTCGCACGGGTGTCTTACGAGACGGTTGGGGTC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1918 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg4 | TGACTGACGACGACTC-CTTGTCCATGGCTTGTCCACTCGGGTGTCTGGACAATGAAACCGAACTGC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1919 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg8 | TGACTGACGACGACTC-AGAACGCTTTATGCGCACGGGGGACTTCGGAGTCGTCGAGTACGGGTACC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | 183.79 ± 3.27 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1920 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg8A | TGACTGACGACGACTCAGAACGCTTTATGCGCACGGGGGACTTCGGAGTCGTCGAGT | 57 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | Achieving a limit of detection of 10 CFU/mL. | 15 | Fluorescence Binding Assay | 133.15 ± 48.56 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1921 | 40053147 | 2025 | Fluorescent aptasensor for detection of Salmonella typhimurium using boric acid-functionalized terbium metal-organic framework and magnetic nanoparticles | Aptamer | TAGGGAAGAGAAGGACATATGATCAGGAGTCATGCTACCACTGGTGATTACGCCTCGCTCAGCTTGACTAGTACATGACCACTTGA | 86 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (MTCC 3232) | Whole cell | A fluorescent detection platform was developed using boric acid-functionalized terbium metal–organic framework (BA-Tb-MOF) and carboxyl-modified magnetic nanoparticles (MNPs) to identify S. typhimurium. | Showed an inverse linear relationship within the range of 10(1)–10(9) CFU/mL, and the detection limit was 4 CFU/mL. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1922 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss1 | TGACTGACGACGACTC-CCCGCAGGGGATCCGGATGCCGCGTTGGAGGAGATATGTATTATTCCATC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | Demonstrated a linear response across a range of 10–10(8) CFU/mL for P. micra with a limit of detection of 11 CFU/mL. | 17 | Fluorescence Binding Assay | 33.84 ± 0.92 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1923 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss2 | TGACTGACGACGACTC-GGAGAACTACCGCACCAACAATTCACCGTCTGGACGTTCTGCCCTCTCCC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1924 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss8 | TGACTGACGACGACTC-GGGAGGTCAGACTATCTTGTTCCTCCTGGAGGTCGGGAAGAGAGTTGACG-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1925 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss9 | TGACTGACGACGACTC-GGGGGCTGTCAAAAATTACTCTTGGGCCCAGCAATGGTAATTTTCTGACC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1926 | 40136943 | 2025 | Nanoparticle-Enhanced Acoustic Wave Biosensor Detection of Pseudomonas aeruginosa in Food | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa PAO1 | Whole cell | Developed a biosensor for detecting P. aeruginosa in whole milk samples using an aptamer functionalized antifouling linking molecule 3-(2-mercaptoethanoxy)propanoic acid (HS-MEG-COOH), and another one with the addition of AuNPs. | Exhibited a linear range 10(2)-10(5) CFU/mL and limit of detection (LOD) of 86 CFU/mL in PBS and 157 CFU/mL in milk, and with AuNPs, reducing the extrapolated LOD to 68 CFU/mL in PBS and 46 CFU/mL in milk. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1927 | 39406088 | 2025 | Laser-induced graphene-based aptasensor for the selective detection of Escherichia coli in urine samples | P12-55 | CATACGATTTAGGTGACACTATAGCCGGAGGGGGGTGAGGTCTGCGGCAGGCTGTGTGGGTGGAATTTCTCCTACTGGGATAGGTGGA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Developed an impedance biosensor using a Laser-Induced Graphene-based (LIG) electrode for the detection of E. coli in urine samples. | The aptasensor showed a linear response to E. coli over the range 10(0)-10(3) CFU/mL and LOD of 9 CFU/mL in PBS. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1928 | 40916637 | 2025 | Study of Bacteriostasis of Kaempferide on Foodborne Pathogenic Bacteria by Indirect Determination of Capillary Electrophoresis | AP1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed an aptamer-based capillary sieving electrophoresis (CE)-Laser-induced fluorescence (LIF) detection of three bacteria, Vibrio parahaemolyticus, Escherichia coli, and Staphylococcus aureus. | The measured limit of detection (LOD) for V. parahaemolyticus was 3.70 × 10(6) CFU/mL and a linear range of 0.80-124 × 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1929 | 40916637 | 2025 | Study of Bacteriostasis of Kaempferide on Foodborne Pathogenic Bacteria by Indirect Determination of Capillary Electrophoresis | AP2 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Developed an aptamer-based capillary sieving electrophoresis (CE)-Laser-induced fluorescence (LIF) detection of three bacteria, Vibrio parahaemolyticus, Escherichia coli, and Staphylococcus aureus. | The measured limit of detection (LOD) for E. coli was 1.28 × 10(7) CFU/mL and a linear range of 6.50 - 153 × 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | Extension chain for AP2 (T2) , 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1930 | 40916637 | 2025 | Study of Bacteriostasis of Kaempferide on Foodborne Pathogenic Bacteria by Indirect Determination of Capillary Electrophoresis | AP3 | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 6538) | Whole cell | Developed an aptamer-based capillary sieving electrophoresis (CE)-Laser-induced fluorescence (LIF) detection of three bacteria, Vibrio parahaemolyticus, Escherichia coli, and Staphylococcus aureus. | The measured limit of detection (LOD) for S. aureus was 1.67 × 10(7) CFU/mL and a linear range of 3.00-150 × 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | Extension chain for AP3 (T3), 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1931 | 39961826 | 2025 | Self-protective DNAzyme-based dual-responsive three-way Y-probe for simultaneous determination of multiple pathogenic bacteria | APT(S) | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT | 59 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (KCTC 1925) | Whole cell | Developed a DNAzyme-based self-protecting dual-response three-way Y nanoprobe (SD-DTY) for the simultaneous detection of two foodborne pathogens. | The limit of detection was 3.2 cfu/mL, and the linear range was 10-10(5) cfu/mL, with a 2-hour response time. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1932 | 39961826 | 2025 | Self-protective DNAzyme-based dual-responsive three-way Y-probe for simultaneous determination of multiple pathogenic bacteria | APT(E) | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACACCTACCCATCGGA | 54 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (KCTC 2571) | Whole cell | Developed a DNAzyme-based self-protecting dual-response three-way Y nanoprobe (SD-DTY) for the simultaneous detection of two foodborne pathogens. | The limit of detection was 3.7 cfu/mL, and the linear range was 10-10(5) cfu/mL, with a 2-hour response time. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1933 | https://doi.org/10.1016/j.snb.2024.136609 | 2025 | Ultrasensitive electrochemical biosensor for bacteria detection based on Fe3O4@COF-AuNPs and trigging isothermal circular amplification | Aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed an ultrasensitive electrochemical biosensor based on magnetic nanocomposite material Fe3O4@COF-AuNPs and triggering isothermal circular amplification (TICA) for E. coli detection. | The detection limit (LOD) was 10 CFU/mL, with a linear range of 10(2)−10(9) CFU/mL, and the detection time was 1 h. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | The sensor was stored at 4°C, and the signal value decreased by only 6.28 % over 30 days. | N/A | N/A | N/A |