AptBacterialDB

Year : 2024

Total records found: 45

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1829 374294292024Assessment of the growth inhibition and anti-biofilm activity of aptamer (PmA2G02) against Proteus mirabilis 1429TPmA2G02ATTACTTACGCTATCTAAttttGCTGTAGGGGAGGAGGGTGGGTtttTTATCATCTGGTATGTTA65N/AssDNAProteus Mirabilis (1429T)BiofilmInhibit biofilm formation, adhesion, and mobility, along with a reduction in biofilm-related genes, namely rsbA, fliC2 & fimD, in P. mirabilis.Aptamer treatment resulted in a 50% reduction in biofilm thickness and a 2.29-fold and 1.34-fold decrease in mRNA expression of the fliC2 and fimD genes, respectively.N/AN/AN/ATherapeuticsWhole Cell-SELEXN/AAptamer treatment did not significantly affect cell viability.N/AN/AN/AN/A
ABdb_1830 382503552024Rapid Detection and Identification of Vancomycin-Sensitive Bacteria Using an Electrochemical Apta-SensorApt1TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC62N/AssDNAStaphylococcus aureus (S. aureus) (RN4220)Whole cellA portable electrochemical biosensor was developed for the identification of Gram-positive bacteria based on a vancomycin-modified screen-printed carbon electrode.Demonstrated that capture was achieved in 10 min, with a limit of detection of only 2.7 CFU/mL.N/AN/AN/ABiosensorN/AN/AN/AN/AN/AN/AN/A
ABdb_1831 382503552024Rapid Detection and Identification of Vancomycin-Sensitive Bacteria Using an Electrochemical Apta-SensorSp14AGCAGCACAGGGTCAGATGATATGTTTACGCCAGTGGTATTATTGGGGTTGATATGTCACCTATGCGTG69N/AssDNABacillus Cereus (ATCC 14579)Whole cellA portable electrochemical biosensor was developed for the identification of Gram-positive bacteria based on a vancomycin-modified screen-printed carbon electrode.Demonstrated that capture was achieved in 10 min, with a limit of detection of only 2.4 CFU/mL.N/AN/AN/ABiosensorN/AN/AN/AN/AN/AN/AN/A
ABdb_1832 388981152024Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1AY-19TCCCTACGGCGCTAAC-GACATGATGGTGCCAAACAACATTCGGAAAGCCTGACCGT-CCACCGTGCTACAAC715'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3'ssDNALegionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152)Whole cellIdentify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection.Limit of Detection (LOD): 4.6 CFU/mL and linear trend ranging from 10 to 10(8) CFU/mL.10Fluorescence Binding Assay14.19 nMDetectionWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/ABest CandidateN/AN/A
ABdb_1833 388981152024Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1AY-3TCCCTACGGCGCTAAC-TGGCAAATAATGCAATTGAAGAAAGCCCCCCCCTGCCCGA-CCACCGTGCTACAAC715'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3'ssDNALegionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152)Whole cellIdentify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection.N/A10Fluorescence Binding Assay15.61 nMDetectionWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_1834 388981152024Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1AY-29TCCCTACGGCGCTAAC-TGTGAAACAAGGCAAGGGAACTGACGTCATAAGGATAGCA-CCACCGTGCTACAAC715'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3'ssDNALegionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152)Whole cellIdentify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection.N/A10Fluorescence Binding Assay17.38 nMDetectionWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_1835 388981152024Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1AY-37TCCCTACGGCGCTAAC-AAGATGAAAGACGACCGGACAGTACATATAGCGCTCTCGC-CCACCGTGCTACAAC715'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3'ssDNALegionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152)Whole cellIdentify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection.N/A10Fluorescence Binding Assay17.96 nMDetectionWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_1836 388981152024Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1AY-31TCCCTACGGCGCTAAC-ACCTGCAGTAGGGAATGCGAATGATGAGACGCCTGATTGG-CCACCGTGCTACAAC715'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3'ssDNALegionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152)Whole cellIdentify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection.N/A10Fluorescence Binding Assay68.83 nMDetectionWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_1837 388981152024Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1AY-24TCCCTACGGCGCTAAC-ACAGACAGAATGAGTGAACATAGGCCAATAACGCACGTCC-CCACCGTGCTACAAC715'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3'ssDNALegionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152)Whole cellIdentify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection.N/A10Fluorescence Binding Assay75.24 nMDetectionWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_1838 https://doi.org/10.1002/adfm.2024034402024Next-Generation Wound Care: Aptamer-Conjugated Polydiacetylene/Polyurethane Nanofibrous Biosensors for Selective In Situ Colorimetric Detection of PseudomonasF23CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas Aeruginosa (ATCC 27853)Whole cellDeveloped an aptamer-modified polydiacetylene-based electrospun nanofibrous wound dressing for the detection of Pseudomonas aeruginosa.The LOD for the aptamer-modified membrane P-F23 was 1.42 × 10(6) CFU/cm^2.N/AN/AN/ABiosensorN/AAmidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1839 https://doi.org/10.1002/adfm.2024034402024Next-Generation Wound Care: Aptamer-Conjugated Polydiacetylene/Polyurethane Nanofibrous Biosensors for Selective In Situ Colorimetric Detection of PseudomonasSt21Lp17AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT38N/AssDNAPseudomonas Aeruginosa (ATCC 27853)Whole cellDeveloped an aptamer-modified polydiacetylene-based electrospun nanofibrous wound dressing for the detection of Pseudomonas aeruginosa.The LOD for the aptamer-modified membrane P-St21Lp17 was 4.46 × 10(6) CFU/cm^2.N/AN/AN/ABiosensorN/AAmidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1840 387706562024Sensitive and on-Site Detection of Staphylococcus aureus Based on CRISPR/Cas 13a-Assisted Chemiluminescence Resonance Energy TransferS. aureus AptamerGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 29213)Whole cellDevelop a CRISPR/Cas 13a-assisted CRET-based strategy for the detection of S. aureus in real samples.Successfully detected S. aureus in drinking water and milk with detection limits of 20 and 30 cfu/mL, respectively, within the recovery of 90.07–105.50%.N/AN/AN/ABiosensorN/A5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1841 397279012024Competitive Electrochemical Apta-Assay Based on cDNA-Ferrocene and MXenes for Staphylococcus aureus Surface Protein A DetectionAPTATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT58N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 25923)Staphylococcus aureus Protein A (SpA)Developed a competitive aptasensor based on a ferrocene (Fc)-labeled cDNA hybridized (cDNA-Fc S13) on a specific aptamer (APT) for PrA in the presence of MXene nanosheets for the indirect detection of S. aureus.Displayed a linear range of 10–125 nM, an LOD of 3.33 nM, and a response time under 40 min.N/AN/AN/ABiosensorN/A3'-Thiolated (HS-(CH2)6)N/AN/AN/AN/AN/A
ABdb_1842 395332982024Rapid detection of Brucella cells using a gold nanoparticle-based aptasensor via a simple colorimetric methodB. melitensis-specific aptamerGAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC38N/AssDNABrucella Melitensis strain Rev. 1 vaccine and Brucella Abortus strain RB51 vaccineWhole cellDetection of Brucella cells using a biosensor, based on gold nanoparticles (GNPs) and a specific aptamer, via a colorimetric reaction.Able to detect 1.5 × 10(1) CFU/mL with a linear range of 1.5 × 10(1)-1.5 × 10(8) CFU/mL of the bacterial cells.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1843 392126952024Visual fluorescence detection of Listeria monocytogenes with CRISPR-Cas12a aptasensorAptamerATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT47N/AssDNAListeria Monocytogenes (ATCC 19115)Whole cellDeveloped an aptasensor utilizing carboxylated magnetic beads and Cas12a to detect L. monocytogenes.Demonstrates excellent sensitivity towards L. monocytogenes, with a lowest detection limit (LOD) of 57.15 CFU/mL and a linear range of 4×10(2) to 4×10(7) CFU/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂-(CH2)6)N/AN/AN/AN/AN/A
ABdb_1844 381509652024Colourimetric and SERS dual-mode aptasensor using Au@Ag and magnetic nanoparticles for the detection of Campylobacter jejuniONS-23GCAAGATCTCCGAGATATCGTGCTGGGGGGTGGTTTGTTTGGGTCGGTTGTTTTGGTTGGGCTGCAGGTAATACGTATACT81N/AssDNACampylobacter Jejuni (ATCC 33291)Whole cellDeveloped a dual-mode aptasensor using aptamer-conjugated Au@Ag NPs for the effective detection of C. jejuni.Exhibit a wider linear range (1.8 × 10(1)–10(8) CFU/mL and a lower limit of detection of 6 CFU/mL.N/AN/AN/ABiosensorN/A5'-Thiolated (for apt-1) and 5′–NH2 (for apt-2)N/AN/AN/AN/AN/A
ABdb_1845 380068172024Electrocatalytic aptasensor for bacterial detection exploiting ferricyanide reduction by methylene blue on mixed PEG/aptamer monolayersAptamerATCCGTCACACCTGCTCTACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTATGGTGTTGGCTCCCGTAT73N/AssDNAEscherichia Coli (E. Coli) strain 8739 (Crooks strain)Outer membrane protein (OMP)Developed a disposable electrocatalytic “off–on” sensor for E. coli on Au SPE.Exhibited a linear range of 10 to 1000 CFU/mL and LOD of 10 CFU/mL E. coli in 30 min.N/AN/AN/ABiosensorN/A3'-Thiolated (thiol-C6)N/AN/AN/AN/AN/A
ABdb_1846 381692792024"Five birds one stone" tri-modal monitoring driven lab-on-magnetic aptasensor for accurate pathogen detection and enhanced germicidal applicationAnti-S. aureus aptamerGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 65389)Whole cellA fluorescence-colorimetric-photothermal tri-modal sensing platform was developed for the detection of S. aureus by apt/KCl@CDs and magnetic multi-walled carbon nanotube composites (M-MWCNTs).The detection limits of fluorescence, colorimetric and photothermal models were 4.81 cfu/mL, 3.40 cfu/mL and 6.74 cfu/mL, respectively with the same linear range of 10 - 1.0 ×10(7) cfu/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂-(CH2)6)N/AN/AN/AN/AN/A
ABdb_1847 380402922024One-pot rapid visual detection of E. coli O157:H7 by label-free AuNP-based plasmonic-aptasensor in water sample(PGM) aptamerCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG42N/AssDNAEscherichia Coli (E. Coli) O157:H7 (ATCC 43895)Whole cellA label-free biosensor was developed using an aptamer and single-pot Au nanoparticle (AuNP) for the detection of E. coli O157:H7.Could identify target bacteria with as few as 250 CFU/ml in 15 min or less.N/AN/AN/ABiosensorN/A5'-Dodeca-G (G12)N/AAfter five days (stored at 4°C) from synthesizing PG-apt-AuNPs, its performance in detecting 10(5) CFU/ml of E. coli O157:H7 is similar to that of newly synthesized biosensor.N/AN/AN/A
ABdb_1848 384525912024Aptamer-mediated double strand displacement amplification with microchip electrophoresis for ultrasensitive detection of Salmonella typhimuriumAptamer (Apt)CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT59N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028)Whole cellDeveloped an aptamer-mediated double SDA-MCE method for ultrasensitive detection of S. typhimurium.Achieved a linear range of 30–1.0 × 10(5) CFU/mL and the limit of detection for S. typhimurium down to 6 CFU/mL.N/AN/AN/ABiosensorN/AN/AN/AN/AN/AN/AN/A
ABdb_1849 https://doi.org/10.1016/j.biosx.2023.1004362024DNA origami-enhanced binding of aptamers to Staphylococcus aureus cellsPA#2/8 [1–58]ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT58N/AssDNAStaphylococcus aureus (S. aureus) SA5Staphylococcus aureus Protein A (SpA)Developed a DNA origami-based biosensor for the detection of SA.Five-times higher affinity of the aptamer-functionalized DNA origami compared to pure aptamers.N/AEnzyme-Linked Oligonucleotide Assay (ELONA)160 ± 9 nMBiosensorN/A5'-PolyA (21A) or PolyT (21 T)N/AN/AN/AN/AN/A
ABdb_1850 https://doi.org/10.1016/j.electacta.2024.1442402024Label-free electrochemical aptasensor for detection of Acinetobacter baumannii: Unveiling the kinetic behavior of reduced graphene oxide v/s graphene oxideAptamerACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC72N/AssDNAAcinetobacter Baumannii (ATCC BAA-2800)Whole cellDeveloped an electrochemical aptasensor that employed a screen-printed carbon electrode modified with both graphene oxide (GO) and reduced graphene oxide (rGO) for the detection of AB.Achieved an impressive limit of detection of 10 CFU/mL and a linear range of 10 to 10(9) CFU/mL.N/AN/AN/ABiosensorN/A5'-BiotinylatedN/AThe current response of aptasensor exhibited negligible changes in the CV signal even after the 4-week storage period.N/AN/AN/A
ABdb_1851 381804962024Development of an electrochemical sensitive aptasensor based on a zeolite imidazolate framework-8 and gold nanoparticles for the determination of Staphylococcus aureus bacteriaAptamerTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC46N/AssDNAStaphylococcus aureus (S. aureus)Whole cellDeveloped an electrochemical aptasensor based on a glassy carbon electrode (GCE) modified with zeolite imidazolate framework-8 (ZIF 8) and gold nanoparticles (AuNPs) for the detection of S. aureus.Showed a linear response in the concentration range of 1.5 × 10(1) to 1.5 × 10(7) CFU mL−1 and a detection limit of 3.4 CFU/mL.N/AN/A(9.04 ± 1.27) × 10(−1) nMBiosensorN/A5'-Amidation (NH₂-(CH2)6)N/AResponse of the proposed aptasensor reached 98.9%, 94.3%, and 92.8% of the initial response on the first, second, and third days, respectively, when kept at 4°C.N/AN/AN/A
ABdb_1852 377516322024A novel paper-based electrochemiluminescence biosensor for non-destructive detection of pathogenic bacteria in real samplesAptamerGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTGCTAACCCCCCTTAATCCCCCC104N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 29213)Whole cellDeveloped a paper-based electrochemiluminescence (ECL) aptasensor based on a Ru-MOF-5 NFs modified Indium tin oxide (ITO) electrode for the detection of S. aureus.Exhibited a linear range from 5 to 10(8) CFU/mL, and a limit of detection (LOD) of 1 CFU/mL.N/AN/AN/ABiosensorN/A5'-COOH (Carboxylated)N/AAfter 9 days at 4°C, the ECL signal of aptsensor retained 95.8% of its initial value, suggesting satisfactory storage stability.N/AN/AN/A
ABdb_1853 https://doi.org/10.1016/j.microc.2024.1114282024Colorimetric and fluorescent dual-mode detection of Escherichia coli using Fe3O4 nanoparticle coated with fluorescein-labeled aptamerE. coli aptamerATCCGTCACACCTGCTCT-ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA-TGGTGTTGGCTCCCGTAT73N/AssDNAEscherichia Coli (E. Coli) BL21 strainOuter membrane protein Ag1 (E. coli OMP Ag1)Developed a dual-mode colorimetric and fluorescence assay employing Fe3O4 nanoparticles (NPs) coated with FAM-Apt for the identification of E. coli.Acheived an impressive limit of detection (LOD) of 10 CFU/mL in the colorimetric mode and 6 CFU/mL in the fluorescence mode.N/AN/AN/ABiosensorN/A5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1854 390963252024Colorimetric aptasensor for Listeria monocytogenes detection using dual functional Fe3O4@MIL-100(Fe) with magnetic separation and oxidase-like activities in food samplesAptamerTACTATCGCGGGAGACAGCGCGGGAGGCACCGGGGA36N/AssDNAListeria Monocytogenes (ATCC 15313)Whole cellDeveloped a colorimetric aptasensor based on magnetic responsiveness and oxidase-like activity of Fe3O4@MIL-100(Fe) for the detection of L.monocytogenes.The linear range was from 10(2) to 10(7) CFU/mL, with the limit of detection as low as 14 CFU/mL.N/AN/AN/ABiosensorN/AN/AN/AN/AN/AN/AN/A
ABdb_1855 388059472024Aptamer-functionalized Fe3O4/MWCNTs@Mo-CDs nanozyme for rapid colorimetric detection toward Escherichia coliE. coli aptamerGCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAEscherichia Coli (E. Coli) (ATCC 8099)Whole cellPeroxidase (POD)-like Fe3O4/MWCNTs@Mo-CDs (FMMC) nanozyme was developed for the colorimetric detection of E. coli.Had a wide linear range of 10(1)–10(6) CFU/mL, low LOD of 0.978 CFU/mL.N/AN/AN/ABiosensorN/AFAM LabeledN/AN/AN/AN/AN/A
ABdb_1856 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterAb1 (A00)TGGTGCGTGCTATTCAGAGT-GAGGGACGCATGATTGGGTGACTCCGGGAGATCATGCAAG-GAACCTGTAGCCACGAATAC805'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3'ssDNAAliarcobacter Butzerli (ATCC 49616)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay14.12 ± 2.31 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1857 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterAb2TGGTGCGTGCTATTCAGAGT-GGGGTGGACCGGGGGGATCGAATAACGCATCGCGCCTAGT-GAACCTGTAGCCACGAATAC805'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3'ssDNAAliarcobacter Butzerli (ATCC 49616)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay26.26 ± 9.87 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1858 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterAb3TGGTGCGTGCTATTCAGAGT-CCTCTAGGCGGTAAGGATCGGACCTTGGTCTGATGGTGAG-GAACCTGTAGCCACGAATAC805'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3'ssDNAAliarcobacter Butzerli (ATCC 49616)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay66.51 ± 24.28 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1859 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterAb4TGGTGCGTGCTATTCAGAGT-GACGGATACGGATTCAGGGCGGAGTGCCAAGATACGGATG-GAACCTGTAGCCACGAATAC805'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3'ssDNAAliarcobacter Butzerli (ATCC 49616)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay97.98 ± 37.42 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1860 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterAb5TGGTGCGTGCTATTCAGAGT-GTTGAGGATTAGGATCGCTTTAAACGATTAGGATCCGAAT-GAACCTGTAGCCACGAATAC805'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3'ssDNAAliarcobacter Butzerli (ATCC 49616)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay142.2 ± 39.3 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1861 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterA01GCGCGGGCTATTCAGAGTGAGGGCCGCGTGAGCGGGCGACTCCGGGAGATCGCGCGCG58N/AssDNAAliarcobacter Butzerli (ATCC 49616)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay27.91 ± 13.34 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1862 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterA02GAGCGGGCGACTCCGGGAGATCGCGCGCGG30N/AssDNAAliarcobacter Butzerli (ATCC 49616)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.Exhibited a wide detection range of up to 1 × 10(7) CFU/mL and the lowest limit of detection (LOD) of 1 CFU/mL, for each bacterium.12Fluorescence Binding Assay6.86 ± 5.77 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_1863 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterA03CGACTCCGGGAGATCG16N/AssDNAAliarcobacter Butzerli (ATCC 49616)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay19.33 ± 9.76 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1864 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterC00GTCCTGAGACTCATGTCTGCTGTCAATCGCAAGGTCCATGTCCTGAGACTCATGTCTGCTGTCAATCGCAAGGTCCA77N/AssDNACampylobacter Jejuni (ATCC 33560)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay48.12 ± 6.15 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1865 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterC01CGCGTGTCTGCTGTCAATCGCAAGGTCCATGTCCCGCG38N/AssDNACampylobacter Jejuni (ATCC 33560)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.Exhibited a wide detection range of up to 1 × 10(7) CFU/mL and the lowest limit of detection (LOD) of 1 CFU/mL, for each bacterium.12Fluorescence Binding Assay27.69 ± 5.66 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_1866 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterC02CGCGAGTCTGCTGTCAATCGCAAGGCGCG29N/AssDNACampylobacter Jejuni (ATCC 33560)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay61.58 ± 19.805 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1867 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterC03CGCTGTCAATCGCG14N/AssDNACampylobacter Jejuni (ATCC 33560)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay240.2 ± 106.85 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1868 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterC04GCGTCCATGTCGC13N/AssDNACampylobacter Jejuni (ATCC 33560)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay259.8 ± 55.1 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1869 376398932024Nano-biosensor based on manganese dioxide nanosheets and carbon dots for dual-mode determination of Staphylococcus aureusAptamer1TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC43N/AssDNAStaphylococcus aureus (S. aureus)Whole cellDeveloped a fluorescence and colorimetry dual-mode sensor to detect S. aureus by MnO2 NSs and CDs.Had a broad linear range of 37 ∼ 3.7 × 10(6) CFU/mL and low detection limits of 9 CFU/mL (ratiometric fluorescence) and 22 CFU/mL (colorimetry).N/AN/AN/ABiosensorN/A5'-COOH (Carboxylated)N/AN/AN/AN/AN/A
ABdb_1870 376398932024Nano-biosensor based on manganese dioxide nanosheets and carbon dots for dual-mode determination of Staphylococcus aureusAptamer2GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT45N/AssDNAStaphylococcus aureus (S. aureus)Whole cellDeveloped a fluorescence and colorimetry dual-mode sensor to detect S. aureus by MnO2 NSs and CDs.Had a broad linear range of 37 ∼ 3.7 × 10(6) CFU/mL and low detection limits of 9 CFU/mL (ratiometric fluorescence) and 22 CFU/mL (colorimetry).N/AN/AN/ABiosensorN/A5'-COOH (Carboxylated)N/AN/AN/AN/AN/A
ABdb_1871 386698462024Ultra-sensitive and rapid detection of Salmonella enterica and Staphylococcus aureus to single-cell level by aptamer-functionalized carbon nanotube field-effect transistor biosensorsS. enterica aptamerTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028)Whole cellDeveloped an aptamer-functionalized CNT-FET biosensor for the detection of these foodborne pathogens.Could detect S. enterica at a limit of detection (LOD) as low as 1 CFU in PBS buffer with a linear range from 62.5–6.4 × 10(4) CFU/mL.N/AFlow Cytometry8.9 ± 2.0 nMBiosensorN/A5'-Thiolated (HS-(CH2)6), 5'-FAM Labeled and 3'-Cyanine5 (Cy5) LabeledN/AN/AN/AN/AN/A
ABdb_1872 386698462024Ultra-sensitive and rapid detection of Salmonella enterica and Staphylococcus aureus to single-cell level by aptamer-functionalized carbon nanotube field-effect transistor biosensorsS. aureus aptamerAACGAGGCGCAGGGGGAGGGGGTGGTACAGATAAGATGGGG41N/AssDNAStaphylococcus aureus (S. aureus) (CMCC(B) 26003)Whole cellDeveloped an aptamer-functionalized CNT-FET biosensor for the detection of these foodborne pathogens.Could detect S. aureus at a limit of detection (LOD) as low as 1.2 CFU in PBS buffer with a linear range from 10(2)-1.28 × 10(4) CFU/mL.N/AFlow Cytometry0.65 ± 0.2 μMBiosensorN/A5'-Thiolated (HS-(CH2)6), 5'-FAM Labeled and 3'-Cyanine5 (Cy5) LabeledN/AN/AN/AN/AN/A
ABdb_2131 https://doi.org/10.1016/j.bioana.2024.05.0042024Aptamer-carbon quantum dots and silver nanoparticles construct a FRET sensor for sensitive detection of E. coliE. coli aptamerN/AN/AN/AssDNAEscherichia Coli (E. Coli) BL21 strainWhole cellDeveloped a FRET-based fluorescent biosensor by combining CQDs with Ag NPs for the rapid detection of E. coli (BL21).The sensor has a linear range of 2×10(3) ∼ to 2×10(8) CFU/mL and a low detection limit of 77 CFU/mL for E. coli.N/AN/AN/ABiosensorN/AN/AN/AN/AN/AN/AN/A