Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 83
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1747 | 37512948 | 2023 | Alpha-Gal Bound Aptamer and Vancomycin Synergistically Reduce Staphylococcus aureus Infection In Vivo | αSA31 | ATGATCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA | 49 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 33591) | Whole cell | αSA31 rescue α-1, 3-galactosyltransferase (−/−) knockout (GTKO) mice from induced MRSA sepsis. | 3.5-fold more (p < 0.05) pretreated MRSA were phagocytized when also treated with αSA31 and 7/12 mice treated with vancomycin plus αSA31 survived in-vivo. | N/A | N/A | N/A | Therapeutics | N/A | 5'-α-gal and 5'-Amidation (NH₂-(CH2)6) | No toxicity was observed, even at 10,000 µg/kg/day. | αSA31NH2 was significantly more stable (p < 0.01) in human serum, as no degradation was observed after 24 h at 37°C. | N/A | 5.222 h in Human serum. | N/A |
| ABdb_1748 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt1 | ATCCAGAGTGACGCAGCA-TGGGACGGTGCGGGGGAGGAGGATGAGCGTGGTCGTTGGGTGGCTGCCGC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | 214.4 nM | Biosensor | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1749 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt1_RC | ATCCAGAGTGACGCAGCA-GCGGCAGCCACCCAACGACCACGCTCATCCTCCTCCCCCGCACCGTCCCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | Using SWV, exhibiting a linear detection range of 4.0 × 10(4)–7.0 × 10(7) CFU/mL, and a limit of detection of 4.0 × 10(4) CFU/mL at pH 5.0. | 8 | Fluorescence Spectroscopy | 3.4 nM | Biosensor | Whole Cell-SELEX | FAM Labeled and Thiolated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1750 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt2 | ATCCAGAGTGACGCAGCA-TGTGGGGGCATGGGAAGGTGGGTAAGCCGTTGCGTGGGATGTGGCGGGTC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1751 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt2_RC | ATCCAGAGTGACGCAGCA-GACCCGCCACATCCCACGCAACGGCTTACCCACCTTCCCATGCCCCCACA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1752 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt3 | ATCCAGAGTGACGCAGCA-TGGGGCGAAGGACGGTGGATGTGTGTAGGCGCGGGTGGGTCGCACGGGGT-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1753 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt3_RC | ATCCAGAGTGACGCAGCA-ACCCCGTGCGACCCACCCGCGCCTACACACATCCACCGTCCTTCGCCCCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1754 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt4 | ATCCAGAGTGACGCAGCA-TGACAGACGGGAGAGACACGACGGGGGCGGGGAGTGAGAAGCGCGCGCTG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1755 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt4_RC | ATCCAGAGTGACGCAGCA-CAGCGCGCGCTTCTCACTCCCCGCCCCCGTCGTGTCTCTCCCGTCTGTCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1756 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt5 | ATCCAGAGTGACGCAGCA-TGTGGCGGTGGCAAGGTCGGTGGGTGCGGCGGCGTACCGGTGGTGGGGGG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1757 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt5_RC | ATCCAGAGTGACGCAGCA-CCCCCCACCACCGGTACGCCGCCGCACCCACCGACCTTGCCACCGCCACA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1758 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt6 | ATCCAGAGTGACGCAGCA-TGACCGGCGGGGGGTGGTTCGCTGATAGGGCGTGTGGACCGGGGGTCGCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1759 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt6_RC | ATCCAGAGTGACGCAGCA-TGCGACCCCCGGTCCACACGCCCTATCAGCGAACCACCCCCCGCCGGTCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1760 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt7 | ATCCAGAGTGACGCAGCA-TGGGCGGGTAGTGGGGCAACGTGAGCGCGTGGGGTGTGGCAGGCGTGGCT-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1761 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt7_RC | ATCCAGAGTGACGCAGCA-AGCCACGCCTGCCACACCCCACGCGCTCACGTTGCCCCACTACCCGCCCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1762 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt8 | ATCCAGAGTGACGCAGCA-AGATGACTTAGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-AATGTCGTTGGTGGCCC | 81 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1763 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt8_RC | ATCCAGAGTGACGCAGCA-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTAAGTCATCT-AATGTCGTTGGTGGCCC | 81 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1764 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt9 | ATCCAGAGTGACGCAGCA-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCATCGAGTGTA-AATGTCGTTGGTGGCCC | 81 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1765 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt9_RC | ATCCAGAGTGACGCAGCA-TACACTCGATGACACACTCTTTCCCTACACGACGCTCTTCCGATCT-AATGTCGTTGGTGGCCC | 81 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1766 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt10 | ATCCAGAGTGACGCAGCA-TGGGTGTGGTGGCGCGGGTGGCGTGGTGCGTGTACAGCTGGTTGCGGGCG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1767 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt10_RC | ATCCAGAGTGACGCAGCA-CGCCCGCAACCAGCTGTACACGCACCACGCCACCCGCGCCACCACACCCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1768 | https:doi.org10.1016j.snb.2023.134218 | 2023 | Dual-mode sensing platform based on aptamer-tunable catalytic activity of mesoporous polydopamine/MnO2 nanozymes for detecting S. aureus | SA31 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTA | 87 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Colourimetric-electrochemical sensing platform to detect S. aureus based on a dual-modal strategy. | Shows a low detection limit in 3 CFU/mL with a linear range between 5 and 10(7) CFU/mL and in a real sample with the recovery of 95.15%− 115.28%. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1769 | 37164985 | 2023 | Selecting antibacterial aptamers against the BamA protein in Pseudomonas aeruginosa by incorporating genetic algorithm to optimise computational screening method | Apt31 | ACCATCTGTGTAAGGGGTAAGGGGTGGGGGTGGGTACGTCT | 41 | N/A | ssDNA | Pseudomonas Aeruginosa | Outer membrane protein BamA (β-barrel assembly machinery A) | Selecting antibacterial aptamers against the BamA protein in Pseudomonas aeruginosa by incorporating a genetic algorithm to optimise the computational screening method. | Treatment of P. aeruginosa with 10 µM Apt31 for 2 h resulted in a significant reduction in CFU/mL and growth percentage. | N/A | N/A | N/A | Therapeutics | In-silico Method | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1770 | 38157041 | 2023 | A point-of-care aptasensor based on the upconversion nanoparticles/MoS2 FRET system for the detection of Pseudomonas aeruginosa infection | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an aptasensor based on FRET between UCNPs-apt/MoS2 for rapid detection of P. aeruginosa. | Exhibit a wide linear detection range 8.7 × 10 ~ 8.7 × 10(7) cfu/mL, and a low limit of detection (LOD) of 15.5 cfu/mL within 1.5 h. | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1771 | https://doi.org/10.1016/j.colsurfa.2023.131955 | 2023 | MoS2 nanosheets based label-free colorimetric aptasensor for Escherichia coli O157: H7 detection | Aptamer | ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed colorimetric aptasensor based on aptamer-functionalized MoS2 nanosheets for the detection of E. coli O157: H7. | Detection of E. coli O157: H7 with a Limit of detection (LOD) of 116 CFU/mL and a linear concentration range of 500–5000 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1772 | 37286753 | 2023 | An ultrasensitive aptamer-based fluorescent on/off system for trace amount evaluation of Yersinia enterocolitica in food samples | Aptamer | AGCAGCACAGAGGTCAGATGCTTGGTTCCACCGTACTGACTGTAGTAAATCTGATCACTCCTATGCGTGCTACCGTGAA | 79 | N/A | ssDNA | Yersinia Enterocolitica (PTCC 1786) | Whole cell | Fluorescence-based aptasensor using graphene oxide (GO) as a quenching platform was developed for the detection of Y. enterocolitica. | Exhibited a wide linear response in the concentration range 10 to 1.0 × 10(9) CFU/mL and the limit of detection (LOD) was 3 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | FAM-aptamer-GO shows better stability in acidic environments, and pH 7 showed the greatest increase. It shows no obvious changes in fluorescence intensity within 60 days. | N/A | N/A | N/A |
| ABdb_1773 | 37921634 | 2023 | Aptamer and DNAzyme-Functionalized Cu-MOF Hybrid Nanozymes for the Monitoring and Management of Bacteria-Infected Wounds | Aptamer | GGGAAAGGGAAAGGGAAAGGG-TTTTTT-ATCCAGACGTGACGCAGCATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTGTGGACACGGTGGCTTAGTA | 102 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | MRSA surface components | G-quadruplex/hemin DNAzyme-aptamer probes and tannic acid-chelated Au nanoparticle (Au-TA)-decorated Cu-based MOF nanosheets (termed GATC) with triple-enzyme activities were developed for visual detection and efficient antibacterial therapy. | ~99.7% MRSA inactivation at 3 μg/mL, with simultaneous colorimetric monitoring of infection. | N/A | N/A | N/A | Therapeutics | N/A | 5'-Thiolated | At 50 μg/mL GATC, the cells showed high viability (>90%), indicating negligible cytotoxicity and good cytocompatibility. The hemolysis rate of the GATC nanozyme was low (<5%). | N/A | N/A | N/A | N/A |
| ABdb_1774 | 37244192 | 2023 | High-throughput, highly sensitive and rapid SERS detection of Escherichia coli O157:H7 using aptamer-modified Au@macroporous silica magnetic photonic microsphere array | Aptamer | TGGTCGTGGTGAGGTGCGTGTATGGGTGGTGGATGAGTGTGTGGC | 45 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC 21530) | Whole cell | An aptamer-Au@MMSPM SERS array biochip method was developed for the detection of E. coli O157:H7. | Gave a wide linear detection range (10–10(6) CFU/mL) and low limit of detection (2.20 CFU/mL) for E. coli O157:H7. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (SH-C12) (of Aptamer 1) and 3'-Amidation (NH₂-(CH2)6) (for Aptamer 2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1775 | 37449120 | 2023 | Colorimetric aptasensor for detection of Bacillus cytotoxicus spores in milk and ready-to-use food | BAS-6R | ATCCGTCACACCTGCTCTGCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGATGGTGTTGGCTCCCGTAT | 71 | N/A | ssDNA | Bacillus Cereus ssp. cytotoxicus (NVH 391-98A) | B. cytotoxicus spores | Develop a colorimetric assay employing AuNPs and magnetic particles (MPs) for the detection of Bacillus cytotoxicus spores in food. | Achieving the naked-eye limit of detection as low as 10(2) cfu/mL in water and milk, and 10(4) cfu/mL in mashed potatoes. | N/A | N/A | N/A | Biosensor | N/A | 5′-Thiolated and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1776 | 36906992 | 2023 | An ultrasensitive electrochemical aptasensor using Tyramide-assisted enzyme multiplication for the detection of Staphylococcus aureus | SA37 | GCTTCCAGCTTATTGAATAAAGACGGGGGGGGGGACCGGCGTATGAGTGAAGATGGGGGCGCTGAAGCGCGGAAGC | 76 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | An electrochemical aptasensor based on the tyramide signal amplification (TSA) technology was developed for the detection of S. aureus. | Achieved a limit of detection (LOD) of 3 CFU/mL in buffer and 8 CFU/mL in both tap water and beef broth. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1777 | 36832038 | 2023 | Applicability of a Green Nanocomposite Consisted of Spongin Decorated Cu2WO4(OH)2 and AgNPs as a High-Performance Aptasensing Platform in Staphylococcus aureus Detection | Apt | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptasensing Platform based on a Green Nanocomposite consisting of Spongin Decorated Cu2WO4(OH)2 and AgNPs for Staphylococcus aureus detection. | Measured S. aureus under a linear concentration range of 10–10(8) CFU/mL and a limit of quantification and detection of 12 and 1 CFU/mL, respectively. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1778 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | T1-280 | ACTGTCrGrCrGrCrArCrGrCrGrUrGrUrGrUrArGrUrArCrArCrArCrGrArUrCrGrCrGrCrGrCrArCrArArUrArU | 46 | N/A | ssRNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of T1-280 RNA was 113 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 2.2 ± 0.5 nM | Detection | In-silico Method | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide | N/A | N/A | N/A | N/A | N/A |
| ABdb_1779 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | T2-139040 | ACTGTCrArArUrUrUrGrArArUrArUrArUrUrArGrUrGrCrGrCrGrCrCrGrUrArGrUrGrUrGrUrArArArArArUrU | 46 | N/A | ssRNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of T2-139040 RNA was 17 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 1.0 ± 0.3 nM | Detection | In-silico Method | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide | N/A | N/A | N/A | N/A | N/A |
| ABdb_1780 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | T3-117558 | ACTGTCrArArUrUrUrGrArGrUrGrUrGrUrGrArUrCrArUrArUrArUrCrGrUrArGrCrGrCrGrCrUrArCrArArCrC | 46 | N/A | ssRNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of T3-117558 RNA was 11 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 0.7 ± 0.4 nM | Detection | In-silico Method | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide | N/A | N/A | N/A | N/A | N/A |
| ABdb_1781 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | A14 | ACTGTCCACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT | 54 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of A14 DNA was 485 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 4 ± 2 nM | Detection | N/A | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1782 | 36549213 | 2023 | Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tags | Apt1 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | A SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus. | The detection limit for E. coli was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1783 | 36549213 | 2023 | Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tags | Apt2 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC 26003) | Whole cell | A SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus. | The detection limit for S. aureus was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1784 | https://doi.org/10.1016/j.snb.2023.133554 | 2023 | A novel Aptamer-induced CHA amplification strategy for ultrasensitive detection of Staphylococcus aureus and NIR-triggered photothermal bactericidal Activity based on aptamer-modified magnetic Fe3O4@AuNRs | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a Fe3O4 @AuNRs-aptasensor based on CHA for ultrasensitive detection of S. aureus. | Achieved a linear response ranging from 10(2) to 10(6) CFU/mL and a detection limit of 10(1) CFU/mL under optimal conditions. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1785 | https://doi.org/10.1016/j.cclet.2022.108102 | 2023 | Rapid detection of pathogenic bacteria based on a universal dual-recognition FRET sensing system constructed with aptamer-quantum dots and lectin-gold nanoparticles | Aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 21530) | Whole cell | Developed a dual-recognition-based sandwich FRET sensor using Aptamer-QDs and Con A-AuNPs for the detection of E. coli. | Achieved a linear detection range from 10(2) cfu/mL to 2 × 10(8) cfu/mL with the detection limit of 45 cfu/mL for E. coli, and LOD in the milk and orange juice was 300 cfu/mL and 200 cfu/mL, respectively. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1786 | https://doi.org/10.1016/j.snb.2023.133745 | 2023 | Dual recognition strategy for the rapid and precise detection of Bacillus cereus using post-modified nano-MOF and aptamer | Aptamer | AGCAGCACAGAGGTCAGATGCCCCCCTTTTATCCGTCGGCATGATGTCTCCCGATCCGGTCCTATGCGTGCTA | 73 | N/A | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | A dual-recognition strategy using a fluorescent probe, FcMBL-coated nano-MIL-53(Al)-NH2, for detecting B. cereus was developed. | Shows a linear range of 20–2 × 10(8) CFU/mL with a limit of detection of 4 CFU/mL within 60 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1787 | 37196408 | 2023 | A SERS bioassay based on vancomycin-modified PEI-interlayered nanocomposite and aptamer-functionalized SERS tags for synchronous detection of Acinetobacter baumannii and Klebsiella pneumoniae | K2 | AATCAGGCTCAGCATGGAGTTGCGAGGCCAATATCCGGTTAAGCG | 45 | N/A | ssDNA | Klebsiella Pneumoniae (KP) | Whole cell | A double-edged sword SERS aptasensor was developed using SPION-PEI-Au-Van nanocomposites for synchronous detection of K. pneumoniae and A. baumannii in food and clinical samples. | Shows a limit of detection was 10 cells/mL with a linear range of 50-10(5) cells/mL for both KP and AB. | N/A | N/A | 5.377 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1788 | 37196408 | 2023 | A SERS bioassay based on vancomycin-modified PEI-interlayered nanocomposite and aptamer-functionalized SERS tags for synchronous detection of Acinetobacter baumannii and Klebsiella pneumoniae | AB | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | A double-edged sword SERS aptasensor was developed using SPION-PEI-Au-Van nanocomposites for synchronous detection of K. pneumoniae and A. baumannii in food and clinical samples. | Shows a limit of detection was 10 cells/mL with a linear range of 50-10(5) cells/mL for both KP and AB. | N/A | N/A | 6.8 nM | Biosensor | N/A | 5'-Cyanine5 (Cy5) Labeled and 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1789 | 37591900 | 2023 | Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samples | LAP1 | GGGCGTTAAAGATACAGGAACCGGTGTCGAGGTCTGAAGAATCCT | 45 | 5'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3' | ssDNA | Leptospira Interrogans | Outer membrane protein (OMP) | Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Modified Microtiter Plate-based Cell SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent Application No. 202241038353 |
| ABdb_1790 | 37591900 | 2023 | Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samples | LAP2 | CGTACGTCTGTCTCTGCATCTTATTGCTATGGAATAATGTTGTTCTGG | 48 | 5'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3' | ssDNA | Leptospira Interrogans | Outer membrane protein (OMP) | Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Modified Microtiter Plate-based Cell SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent Application No. 202241038353 |
| ABdb_1791 | 37591900 | 2023 | Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samples | LAP3 | TGGCGTTAGAGATACCGGAACCGGTGTCGGGCGTCTGAAGAATCC | 45 | 5'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3' | ssDNA | Leptospira Interrogans | Outer membrane protein (OMP) | Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection. | Exhibited a detection limit of 57 CFU/mL and a linear response in the concentration range of 6 × 10(5) to 60 CFU/mL. | 10 | Fluorescence Spectroscopy | 133.13 ± 22 nM | Biosensor | Modified Microtiter Plate-based Cell SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | Patent Application No. 202241038353 |
| ABdb_1792 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt (mono-apt) | GAGAGAGAATATAAGGGAAAAAAAAAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 82 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | N/A | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 389.63 nM (with mono-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1793 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt1 (multi-apt) | GAAGTGTACGTAGCCTGATTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1794 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt2 (multi-apt) | TCGTCTACACTACTGCTCTTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1795 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt3 (multi-apt) | TCTCCAATGACGTACCTGTTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1796 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt4 (multi-apt) | GTTGCAGTACTCTACGAGTTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1797 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt5 (multi-apt) | TGTACTGGACAAGTGACGTTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1798 | 37187062 | 2023 | A universal bacterial sensor created by integrating a light modulating aptamer complex with photoelectrochemical signal readout | Peptidoglycan aptamer | GCAGTTGCGGGACAGGGAGTGCGCTGCTCCCC | 32 | N/A | ssDNA | Escherichia Coli (E. Coli) | Peptidoglycan | Developed a signal-on photoelectrochemical biosensor for detecting peptidoglycan. | Demonstrate a limit-of-detection of 82 pg/mL (13 pM) in buffer and 239 pg/mL (37 pM) in urine for peptidoglycan and 1913 CFU/mL for Escherichia coli in urine. | N/A | N/A | 0.415 ± 0.047 μM | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1799 | 36961921 | 2023 | Dual Synthetic Receptor-Based Sandwich Electrochemical Sensor for Highly Selective and Ultrasensitive Detection of Pathogenic Bacteria at the Single-Cell Level | S. aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | An electrochemical sandwich sensor was developed for the detection of a single bacterial cell based on dual recognition by the bacteria-imprinted polymer film (BIF) and aptamer (Au@Fc-Apt). | The sensor could detect as low as 10 CFU/mL in a milk sample and 1 CFU/mL in PBS with a linear range from 10 to 10(5) CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | After storage at 4°C for 17 days, the sensor still retained about 92% of the initial detection signal. | N/A | N/A | N/A |
| ABdb_1800 | https://doi.org/10.1002/celc.202300257 | 2023 | Rolling Circle Amplification/G-Quadruplex-Based Dual-Signal Ratiometric Electrochemical Aptasensor for Ultrasensitive Detection of Pathogenic Bacteria | Aptamer (P1) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 87 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923 and ATCC 29213) | Whole cell | Developed a ratiometric dual-signal electrochemical biosensor for ultrasensitive detection of S. aureus based on an aptamer recognition-induced rolling circle amplification (RCA)/G-quadruplex strategy. | Showed a good linear relationship between 10–10(6) CFU/mL with a detection limit of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | Ferrocene (Fc) conjugated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1801 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B3 | AGCAGCACAGAGGTCAGATG-AGGCCCGGGTTTGGTTCTGGGGTTGGCGGGCTGCGTGAGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1802 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B4 | AGCAGCACAGAGGTCAGATG-GAAGGGTTTGGTGGTAAATTGCGTGGTTGGCTGTTGATGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1803 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B6 | AGCAGCACAGAGGTCAGATG-GGCGGGTTTGGATCTTTGGTTGGCGCTTGTTTCTTTATGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1804 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B7 | AGCAGCACAGAGGTCAGATG-TCGGTCGGGTTTGGGTGTTGGTTGGCGATAAAGATAACTG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | 19.64 ± 4.11 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1805 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B11 | AGCAGCACAGAGGTCAGATG-GTGTAGGTCAATCGACGCCACCCATAGCAACCATCCTGCG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1806 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B14 | AGCAGCACAGAGGTCAGATG-GTGGGCAGTGGGGGGAGGGGGAGGTGGAGGTTAGACGTGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | 28.64 ± 3.10 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1807 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B15 | AGCAGCACAGAGGTCAGATG-GGCGGGTTTGGATCTTTGGTTGGCGCCTGTTTCTTTATGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | Achieve highly sensitive detection of B. cereus as low as 10 cfu/mL. | 16 | Flow Cytometry | 16.13 ± 4.98 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1808 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B16 | AGCAGCACAGAGGTCAGATG-ATATGTTTACGCCAGTGGTATTATTGGGGTTGATATGTCA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | Achieve highly sensitive detection of B. cereus as low as 10 cfu/mL. | 16 | Flow Cytometry | 20.67 ± 5.23 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1809 | 37619902 | 2023 | Development of a label-free impedimetric aptasensor for the detection of Acinetobacter baumannii bacteria | Aptamer | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | An electrochemical aptasensor was developed using an aptamer immobilized on the surface of a CSPE modified with the nanocomposite Fe3O4@SiO2@Glyoxal (Gly) for A. baumannii detection. | Specifically detect A. baumannii in the concentration range from 1.0 × 10(3)–1.0 × 10(8) CFU/mL and with a detection limit of 150 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The current response from 0 day to 28 days was 94.3%, 90%, and 86.5% of the primary Rct response of the aptasensor remained at 4°C after 14, 21 and 28 days, respectively. | N/A | N/A | N/A |
| ABdb_1810 | 37437266 | 2023 | Specific Instantaneous Detection of Klebsiella pneumoniae for UTI Diagnosis with a Plasmonic Gold Nanoparticle Conjugated Aptasensor | KPBA1 | GGCTGGATGGGGCGTGT-GGAGCCCCGTTAGAATATCAGAGGTGGTGG-CAACGGTGCGGACAGCG | 64 | 5'-GGCTGGATGGGGCGTGT-30N-CAACGGTGCGGACAGCG-3' | ssDNA | Klebsiella Pneumoniae (MTCC-7028) | Whole cell | Developed localized surface plasmon resonance (LSPR) aptasensor using a tailor-made plasmonic aptamer-gold nanoparticle (AuNP) for detection of Klebsiella pneumoniae. | LoD as low as 3.4 × 10(3) CFU/mL within 5 min. | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5′-Thiolated (5′-/5ThioMC6-D) and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1811 | https://doi.org/10.3390/fishes8100477 | 2023 | A Novel Method for Sensitive Detection of Vibrio alginolyticus Based on Aptamer and Hybridization Chain Reaction in Aquaculture | Aptamer | GAGAGAGAATATAAGGGAAAAAAAATCAGTCGCTTCGCCGTCTCCTTCGGGGGCGCGGTGAGGGGCTGCACAAGAGGGAGGCACAAGAGGGAGACCCCAGAGGG | 104 | N/A | ssDNA | Vibrio Alginolyticus (ATCC 17749) | Whole cell | Developed a method using an HCR-based multivalent aptamer (multi-Apt) for the detection of Vibrio alginolyticus. | Obtained a linear range from 10 to 10(7) CFU/mL, and the limit of detection (LOD) is 3 CFU/mL. | N/A | N/A | N/A | Detection | N/A | SA-HRP or 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1812 | 37893744 | 2023 | A Colorimetric/Fluorescent Dual-Mode Aptasensor for Salmonella Based on the Magnetic Separation of Aptamers and a DNA-Nanotriangle Programmed Multivalent Aptamer | Apt1 | GAAGTGTACGTAGCCTGATTCTTGGGCGGTTGGTGTGATGGGCTTTTTTCGTTGGGCCGG | 60 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric/fluorescent dual-mode method based on a DNA-nanotriangle programmed multivalent aptamer (NTri-Multi-Apt) for the detection of Salmonella. | Achieved a linear range of 1.0 × 10(2)–1.0 × 10(7) CFU/mL and LODs of 316 and 60 CFU/mL for colorimetric and fluorescent detection, respectively. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.89 nM | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1813 | 37893744 | 2023 | A Colorimetric/Fluorescent Dual-Mode Aptasensor for Salmonella Based on the Magnetic Separation of Aptamers and a DNA-Nanotriangle Programmed Multivalent Aptamer | Apt2 | TACTGCTCTTCTTGGGCGGTTGGTGTGATGGGCTTTTTTCGTTGGGCCGG | 50 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric/fluorescent dual-mode method based on a DNA-nanotriangle programmed multivalent aptamer (NTri-Multi-Apt) for the detection of Salmonella. | Achieved a linear range of 1.0 × 10(2)–1.0 × 10(7) CFU/mL and LODs of 316 and 60 CFU/mL for colorimetric and fluorescent detection, respectively. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.89 nM | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1814 | 37893744 | 2023 | A Colorimetric/Fluorescent Dual-Mode Aptasensor for Salmonella Based on the Magnetic Separation of Aptamers and a DNA-Nanotriangle Programmed Multivalent Aptamer | Apt3 | CGTACCTGTTCTTGGGCGGTTGGTGTGATGGGCTTTTTTCGTTGGGCCGG | 50 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric/fluorescent dual-mode method based on a DNA-nanotriangle programmed multivalent aptamer (NTri-Multi-Apt) for the detection of Salmonella. | Achieved a linear range of 1.0 × 10(2)–1.0 × 10(7) CFU/mL and LODs of 316 and 60 CFU/mL for colorimetric and fluorescent detection, respectively. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.89 nM | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1815 | https://doi.org/10.1016/j.cej.2023.143099 | 2023 | Design nanoprobe based on DNA tetrahedron supported hybridization chain reaction and its application to in situ analysis of bacteria | Aptamer (AA) | AGTGCGCAGCTAGCAAGGCCTTTTTTTTTTGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 118 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 6538) | Whole cell | Developed a nanoprobe (DTAAT) based on DNA tetrahedral supported hybridization chain reaction (HCR) for in situ analysis of SA. | Detect SA with the detection limit as low as 26 CFU/mL and linear range of 50-5×10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled and 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1816 | 36493674 | 2023 | Sandwich-Type Electrochemical Aptasensor for Highly Sensitive and Selective Detection of Pseudomonas Aeruginosa Bacteria Using a Dual Signal Amplification Strategy | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15442) | Whole cell | Developed a sandwich-type electrochemical aptasensor using a carbon screen-printed electrode (MIL101(Cr)/MWCNT) and AgNPs/C-g-C3N4/Apt for P. aeruginosa detection. | Display a limit of detection of 1 CFU/mL and a linear range of 10 to 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The DPV current intensity of the aptasensor for 10(5) CFU/mL of P. aeruginosa was approximately 92.4% of its initial signals after 21 days stored at 4°C. | N/A | N/A | N/A |
| ABdb_1817 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 10473) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 5.70 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1818 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | E. coli aptamer | CAGCTCAGAAGCTTGATCCTACCAGTAGACTTTCAACTTTACTGCCATCGTGTGCCCTAAGACTCGAAGTCGTGCATCTG | 80 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 10372) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1819 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. flexneri aptamer | CAGCAACACTGCAACACTGTATAGTCCTGTGTGCC | 35 | N/A | ssDNA | Shigella Flexneri (CGMCC 1.1868) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.72 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1820 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (CICC 21636) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 3.84 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1821 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.27 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1822 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | L. monocytogenes aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (CICC 21635) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 3.16 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1823 | 36166924 | 2023 | Ultrasensitive multicolor electrochromic sensor built on closed bipolar electrode: Application in the visual detection of Pseudomonas aeruginosa | Aptamer | TTTTTCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 65 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Whole cell | An ultrasensitive multicolour electrochromic platform based on a closed bipolar electrode (BPE) was developed for visual sensing of P. aeruginosa. | The detection limit was as low as 0.33 CFU/mL, and the linear range was 10(0)-10(8) CFU/mL within 30 min by the naked eye. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1824 | https://doi.org/10.1016/j.microc.2023.108605 | 2023 | A SERS biosensor based on aptamer-based Fe3O4@SiO2@Ag magnetic recognition and embedded SERS probes for ultrasensitive simultaneous detection of Staphylococcus aureus and Escherichia coli | S. aureus aptamer (P1) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (BNCC 186335) | Whole cell | Developed a SERS biosensor based on aptamer-modified Fe3O4@SiO2@Ag and Au-MPBA/DTNB@Ag for simultaneous detection of S.aureus and E.coli. | Rapidly detect S. aureus with the limit of detection (LOD) of 1 CFU/mL in 20 min and a linear range from 10(1) ∼ 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1825 | https://doi.org/10.1016/j.microc.2023.108605 | 2023 | A SERS biosensor based on aptamer-based Fe3O4@SiO2@Ag magnetic recognition and embedded SERS probes for ultrasensitive simultaneous detection of Staphylococcus aureus and Escherichia coli | E. coli aptamer (P2) | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) (BNCC 336902) | Whole cell | Developed a SERS biosensor based on aptamer-modified Fe3O4@SiO2@Ag and Au-MPBA/DTNB@Ag for simultaneous detection of S.aureus and E.coli. | Rapidly detect E. coli with the limit of detection (LOD) of 1 CFU/mL in 20 min and a linear range from 10(1) ∼ 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1826 | https://doi.org/10.1016/j.microc.2023.108681 | 2023 | An electrochemical and colorimetric dual-mode aptasensor for Staphylococcus aureus based on a multifunctional MOF and magnetic separation technique | S. aureus Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a colorimetric and electrochemical dual-mode aptasensor based on ssDNA-Au/CuMOF and MB-Apt for S. aureus detection. | Display a broad linear range from 10 to 10(8) CFU/mL, with colorimetric minimum resolution of 48 CFU/mL, and electrochemical detection limit of 5 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1827 | 37311299 | 2023 | Joint concanavalin A-aptamer enabled dual recognition for anti-interference visual detection of Salmonella typhimurium in complex food matrices | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A dual recognition platform based on Concanavalin A (Con A)-aptamer joint strategy for sensitive determination of S. typhimurium. | Exhibited linear range of 7.0 × 10(1) ∼ 7.0 × 10(9) CFU/mL, along with a detection limit as low as 23 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1828 | 37466698 | 2023 | A signal-off aptasensor for the determination of Acinetobacter baumannii by using methylene blue as an electrochemical probe | Apt | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Developed an electrochemical aptasensor with Apt/MWCNT@Fe3O4@SiO2-Cl/CSPE nanocomposite to detect A. baumannii. | Display a linear range of 10.0–1.0 × 10(7) CFU/mL and a detection limit of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The current density of the aptasensor for 10(5) CFU/mL of A. baumannii was approximately 92.3% of its initial signals after 21 days. | N/A | N/A | N/A |
| ABdb_2130 | 37773421 | 2023 | Sensitive detection of Escherichia coli in diverse foodstuffs by electrochemical aptasensor based on 2D porphyrin-based COF | Aptamer | N/A | N/A | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed an electrochemical aptasensor using two-dimensional porphyrin-based covalent organic framework (Tph-TDC-COF) for the detection of E.coli. | Demonstrated an extremely low detection limit of 0.17 CFU/mL for E.coli detection within a linear range of 10 to 1 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | The aptasensor recovered to 104.3% after 15 days of storage at 4°C in 0.01 M phosphate buffer, indicating excellent stability. | N/A | N/A | N/A |