Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 111
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1503 | 34347427 | 2021 | Aptamer-Functionalized DNA-Silver Nanocluster Nanofilm for Visual Detection and Elimination of Bacteria | Apt-G | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACGGGTGGGGTGGGGTGGGG | 80 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | DNA-templated silver nanoclusters (N4-AgNC/Apt-G) for the visual detection and effective elimination of bacteria. | After treatment with 5 μM N4-AgNCs/Apt-G, a significantly reduced number of colonies was observed. At the lowest inhibitory concentration of 6.25 μM, the number of colonies decreased by only 4-fold, which is significantly less than the 7-fold reduction observed at 5 μM. Obtained recovery rates ranging from 88% to 115% of S. aureus. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | N/A | N4-AgNCs/Apt-G was found to be nontoxic at low concentrations, and cell viability was more than 80% at a concentration of 6.25 μM. | N/A | N/A | N/A | N/A |
| ABdb_1504 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-10 (truncated) | GGCAGGACACCGTAACGGGTATGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTGCTGCT | 61 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | The detection limit of Biotin-XK-10 was 104 CFU/mL, and that of Biotin-Ag-XK-10 was 103 CFU/mL. | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | 0.81 ± 0.13 nM (by SPR) and 12.9 ± 1.03 nM (by microarray chip) | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1505 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-1 | ACCCCATATCGCGTCAAATTTGGCTACCTCACATGCCCAC | 40 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1506 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-2 | GACAGGCAGGACACCGTAAC-AAGCCCGTGCGGCTTCGTGCGATGGATACAGTGGGCGGGG-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1507 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-3 | GACAGGCAGGACACCGTAAC-ACTAGTAACCCCTAACATCTTCCGCGTTCTTATAGGCCCC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1508 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-4 | GACAGGCAGGACACCGTAAC-ACTCCATGGGGTTTGTAGGGCTCGCTGTAATTATACTTTA-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1509 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-5 | GACAGGCAGGACACCGTAAC-ACTCCCCCTTCCCTGTCTGCTCTACCTGCCTGTTCCCTGC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1510 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-6 | GACAGGCAGGACACCGTAAC-AGGTTGTTGCCGCTCCCCTCGTCTGTTGGGGGTTGTCCTC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1511 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-7 | GACAGGCAGGACACCGTAAC-ATAACTTCTCTCCCGTCAGTCTCCGCAGCCCCATTCCATC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1512 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-8 | GACAGGCAGGACACCGTAAC-ATCGCAGGGCCCCCGTTATTATTCCCCACTTCCTTCTGTC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1513 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-9 | GACAGGCAGGACACCGTAAC-CGGGCTTATCGGTCCGTCTGGAAGGTCCTTTCCTATTCGC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1514 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-10 | GACAGGCAGGACACCGTAAC-GGGTATGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTG-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1515 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-11 | GACAGGCAGGACACCGTAAC-GGGTATACAGCTATCCCGGGCGCTGTCTGAAGATCGTGTG-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1516 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-12 | GACAGGCAGGACACCGTAAC-GGGTATGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1517 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-13 | GACAGGCAGGACACCGTAAC-GGGTACGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTG-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1518 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-14 | GACAGGCAGGACACCGTAAC-GTACTGCCTCCCTCCTGCCGTCCCTCTCTCTAGTCTCTGC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1519 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-15 | GACAGGCAGGACACCGTAAC-GTCCGCCTCTGTATTCCTGCCTCTGTTCCTGCCTTCTGTC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1520 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-16 | GACAGGCAGGACACCGTAAC-TATACCTTCCATCCCGGTCCTGCTCCTCGTCTTTTGTGTC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1521 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-17 | GACAGGCAGGACACCGTAAC-TCCCACCTCTTCCCCCCTTCTAGGTTCATCTCGCGCCACC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1522 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-18 | GACAGGCAGGACACCGTAAC-TCGTCATTCGTCATTCCTGCCCTTTCCTGCCTGATCTGTC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1523 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-19 | GACAGGCAGGACACCGTAAC-TGCCCTCCCTTCCTGCCTGGTCCTGCCGTATTATTTTGTC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1524 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-20 | GACAGGCAGGACACCGTAAC-TTTCCTGTATTGTGGAAGTAAACGTCTGAGTGGTCGATGT-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1525 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-2 | AAGGAGCAGCGTGGAGGTTA-CCAGGAGGACCCTATTCTCGTGTATCGACGAGATCCAGTG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | Limit of detection (LOD) of HPA-2 was 88 cfu/mL. | 9 | Fluorescence Spectroscopy | 19.3 ± 3.2 nM | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1526 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-1 | AAGGAGCAGCGTGGAGGTTA-CGCCTGATCCAGGTGCTATCTTCCGCCCTGTTTCTTTGGT-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1527 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-3 | AAGGAGCAGCGTGGAGGTTA-CTCCTCGGTCCTTTCAGGTAGACGCTCTTACGCCCTCAGT-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | The binding ability order was HPA-2 > HPA-3 > HPA-5 > HPA-9. | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1528 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-4 | AAGGAGCAGCGTGGAGGTTA-CGTGTATCCCCTGTGTGTTTGTACTCGGCTACTGTATCCG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1529 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-5 | AAGGAGCAGCGTGGAGGTTA-CTCGTTTGGATACGTCATCGGTAGGACTACGGTACCTAAAC-ACCACGACGACACACCCTAA | 81 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | The binding ability order was HPA-2 > HPA-3 > HPA-5 > HPA-9. | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1530 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-6 | AAGGAGCAGCGTGGAGGTTA-GCACAGGAGACAGGGGGAGATGATACTCGGCGTTTCAAGG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1531 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-7 | AAGGAGCAGCGTGGAGGTTA-CTCGCGCCCTTCTTTCAGTAGCAGTGTACGGATCTTGCGG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1532 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-8 | AAGGAGCAGCGTGGAGGTTA-TGCATATCGCTAGCTGATAAGCTGATGCCATCGTGTCTAC-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1533 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-9 | AAGGAGCAGCGTGGAGGTTA-GCATCTTTGAGGAATTTTCGTCAAAGGACCGAGTAACGGC-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | The binding ability order was HPA-2 > HPA-3 > HPA-5 > HPA-9. | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1534 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-10 | AAGGAGCAGCGTGGAGGTTA-AGTTGCTCTTGATCGTCGACCAGTCGCTATGCAGCACCCC-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1535 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-11 | AAGGAGCAGCGTGGAGGTTA-CTGCACGAATGATCCCCCGCCATGCTGTAGTTCCGTCTTA-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1536 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-12 | AAGGAGCAGCGTGGAGGTTA-CTGTAACGCCCCGCTGATTCTTTCTCAGCGTGCTAGGCGG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1537 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-13 | AAGGAGCAGCGTGGAGGTTA-ATCGCTCCGTCCAGTAAGAGTTGCCTACAATGCCCGCCGGC-ACCACGACGACACACCCTAA | 81 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1538 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-14 | AAGGAGCAGCGTGGAGGTTA-CAAATGAGCCTTAGAGCTGTGCAGAGTTCGAAGCTTGGTG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1539 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-15 | AAGGAGCAGCGTGGAGGTTA-CCTCGGTGTTCGTTCTGACTACGTTCCCTGGGACCCGCGT-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1540 | 34664941 | 2021 | Efficient Eradication of Bacterial Biofilms with Highly Specific Graphene-Based Nanocomposite Sheets | S. Typhimurium aptamer (ST-NH2) | TTTTTAAGCCCACTGGCGTTCGGACATCACAGCTCGTGCAGGTCGTGCCATG | 52 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CMCC 50115) | Whole cell | ICG@GO-Apt nanosheets for eradication of biofilm associated with Salmonella Typhimurium. | Shows an efficient biofilm elimination with an efficiency of greater than 99.99% in an abscess formation model. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Amidation (NH₂) or TAMRA, 5'-FAM Labeled or Amidation (NH₂) | ICG@GO-Apt NSs had almost no cytotoxicity to HEK 293 cells, with more than 90% and lacked hemolytic activities. | N/A | N/A | N/A | N/A |
| ABdb_1541 | 33285125 | 2021 | An aptamer biosensor based dual signal amplification system for the detection of salmonella typhimurium | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ASI 1174) | Whole cell | Developed a signal-cascade-amplification method named “immuno-HCR-SERS” for the detection of S. typhimurium. | Highly sensitive detection showing a linear range from 10 to 10(5) CFU/mL, with a limit of detection (LOD) of 6 CFU/mL in 3.5 h. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1542 | 34828820 | 2021 | A Colorimetric Strategy Based on Aptamer-Catalyzed Hairpin Assembly for the On-Site Detection of Salmonella typhimurium in Milk | Capture aptamer (Bapt) | GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colourimetric assay based on aptamer-catalysed hairpin assembly signal amplification strategy (Y-CHA ) for the detection of S. typhimurium in milk. | Exhibited a concentration range of 10(2) to 10(6) CFU/mL, with a sensitivity of 2.4 × 10(2) CFU/mL under optimal conditions and 2.8 × 10(3) CFU/mL in real milk samples. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1543 | 34828820 | 2021 | A Colorimetric Strategy Based on Aptamer-Catalyzed Hairpin Assembly for the On-Site Detection of Salmonella typhimurium in Milk | Target aptamer (Tapt) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colourimetric assay based on aptamer-catalysed hairpin assembly signal amplification strategy (Y-CHA ) for the detection of S. typhimurium in milk. | Exhibited a concentration range of 10(2) to 10(6) CFU/mL, with a sensitivity of 2.4 × 10(2) CFU/mL under optimal conditions and 2.8 × 10(3) CFU/mL in real milk samples. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1544 | 34051601 | 2021 | Sensitive detection of S. Aureus using aptamer- and vancomycin -copper nanoclusters as dual recognition strategy | Aptamer | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed an aptamer- and antibiotic-based dual detection sensor, combines copper nanoclusters (CuNCs) for the detection of S. aureus. | Showed a linear range of 10(2)-10(8) CFU/mL, and a detection limit of 80 CFU/mL after 45 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1545 | https://doi.org/10.1016/j.electacta.2021.139633 | 2021 | A new electrochemical aptasensor based on gold/nitrogen-doped carbon nano-onions for the detection of Staphylococcus aureus | Anti-S. aureus aptamer | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an electrochemical aptasensor based on SPEs modified with AuNPs and NCNOs for the detection of S. aureus. | Measured S. aureus quickly with a limit of detection of 3 CFU/mL in the linear range of 10–10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1546 | 34660993 | 2021 | Detection of Listeria monocytogenes Using Luminol-Functionalized AuNF-Labeled Aptamer Recognition and Magnetic Separation | Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Developed an aptamer-linked biofunctional magnetic nanomaterial system for highly sensitive and specific LM detection. | Display a linear concentration range 1.0 × 10(1)-1.0 × 10(5) CFU/mL and detect L. monocytogenes at levels as low as 6 CFU/mL in milk samples. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1547 | 34107210 | 2021 | A Low-Field Magnetic Resonance Imaging Aptasensor for the Rapid and Visual Sensing of Pseudomonas aeruginosa in Food, Juice, and Water | Anti-P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed a low-field magnetic resonance imaging (LF-MRI) aptasensor based on the difference in magnetic behaviour of two magnetic nanoparticles with diameters of 10 (MN10) and 400 nm (MN400) for the rapid detection of P. aeruginosa. | Show a detection limit of 100 cfu/mL with a wide linear range from 3.1 × 10(2) to 3.1 × 10(7) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1548 | 34396009 | 2021 | DNA Aptamer-Conjugated Magnetic Graphene Oxide for Pathogenic Bacteria Aggregation: Selective and Enhanced Photothermal Therapy for Effective and Rapid Killing | MRSA aptamer | ATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA | 75 | 5'-ATCCAGACGTGACGCAGC-N38-TGGACACGGTGGCTTAGTA-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Apt@MGO nanoplatform for selective and rapid eradication of MRSA under NIR laser irradiation. | Apt@MGO resulted in ∼78% MRSA and over >97% MRSA cell inactivation in dispersed and aggregated states, respectively, under 200 seconds of exposure to NIR irradiation (808 nm, 1.1 W cm–2). | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Amidation (NH₂) and 5'-FITC Labeled | The aptamer itself did not cause any cell activation when incubated with MRSA cells, and also under no NIR laser illumination. | N/A | N/A | N/A | N/A |
| ABdb_1549 | 33076089 | 2021 | Enhancement of the peroxidase-like activity of aptamers modified gold nanoclusters by bacteria for colorimetric detection of Salmonella typhimurium | Aptamer1 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor using gold nanoclusters (aptamers@BSA-AuNCs) for the detection of S. typhimurium. | Exhibited a wide linear range of 10(1)-10(6) cfu/mL with a detection limit as low as 1 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1550 | 33076089 | 2021 | Enhancement of the peroxidase-like activity of aptamers modified gold nanoclusters by bacteria for colorimetric detection of Salmonella typhimurium | Aptamer2 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor using gold nanoclusters (aptamers@BSA-AuNCs) for the detection of S. typhimurium. | Exhibited a wide linear range of 10(1)-10(6) cfu/mL with a detection limit as low as 1 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1551 | 33076147 | 2021 | Ratiometric fluorescence resonance energy transfer aptasensor for highly sensitive and selective detection of Acinetobacter baumannii bacteria in urine sample using carbon dots as optical nanoprobes | Ab aptamer | CAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 71 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | Develop an ingenious ratiometric fluorescent aptasensor for the detection of (Ab) bacteria based on FRET between ortho-phenylenediamine carbon dots (o-CD), nitrogen-doped carbon nanodots (NCND), and graphene oxide (GO). | Display linear range from 2.0 × 10(3) to 4.5 × 10(7) cfu/mL and the low detection limit of 3.0 × 10(2) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | After a storage period of 4 weeks, over 90% of the initial response remained of the aptasenosr. | N/A | N/A | N/A |
| ABdb_1552 | https://doi.org/10.1016/j.microc.2021.106388 | 2021 | Rapid and sensitive determination of Pseudomonas aeruginosa by using a glassy carbon electrode modified with gold nanoparticles and aptamer-imprinted polydopamine | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an electrochemical sensor based on a combination of aptasensing and molecular imprinting employing GCE/AuNP/Aptamer-MIP for ultrasensitive detection of P. aeruginosa. | Exhibited a wide linear dynamic concentration range of 10(1) to 10(7) CFU/ml with a low detection limit of 1 CFU/ml. | N/A | N/A | N/A | Detection | N/A | 5'-Amidation (NH₂) | N/A | The GCE/AuNP/Aptamer-MIP aptasensor signal remained unchanged, and only a 3% decrease in the peak current occurred after 50 repetitive cycles. | N/A | N/A | N/A |
| ABdb_1553 | 34578762 | 2021 | Aptasensor for the Detection of Mycobacterium tuberculosis in Sputum Utilising CFP10-ESAT6 Protein as a Selective Biomarker | Aptamer | GCCTGTTGTGAGCCTCCTAACCCCATCTTATACGTATATGGACTCATCTCGACCCCCGATAGGCTTGGTACATGCTTATTCTTGTCTCCC | 90 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT6/CFP10 fusion proteins (EC proteins) | Developed a portable electrochemical aptamer-antibody-based sandwich biosensor via CapApt/GP/PANI-modified SPGE surface for M. tb. detection in clinical sputum samples. | Detection of the CFP10-ESAT6 antigen ranged from 5 to 500 ng/mL, with a detection limit of 1.5 ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1554 | 34940268 | 2021 | One-Step Fabrication of Stimuli-Responsive Chitosan-Platinum Brushes for Listeria monocytogenes Detection | Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes (ATCC 15313) | Internalin A (InlA) | Developed a label-free electrochemical biosensor using a new one-step simultaneous sonoelectrodeposition of platinum and chitosan (CHI/Pt) to create a biomimetic nanostructure for Listeria monocytogenes detection. | LOD of the CHI/Pt-aptamer brushes in PBS was 2.5 ± 0.3 CFU/mL, 3.3 ± 0.9 CFU/mL in chicken broth. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1555 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | E18R-42 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 10899) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1556 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | E17F-37 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 10899) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1557 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A1 | TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (CICC 21617) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1558 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A3 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (CICC 21617) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1559 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A18P | ATAGGAGTCACGACGACCAGAAGCGGGCAGCTCCACCGGTAGGCTCCGAGTCATCACGGTCGTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (CICC 21617) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1560 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | B1P | ATAGGAGTCACGACGACCAGGGGGGCGGGCGGGCCAGGCGAGGGGCAGGGCGTGGAGGGCTATGTGCGTCTACCTCTTGA | 80 | N/A | ssDNA | Cronobacter Sakazakii (CICC 21562) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | 56.56 ± 10.51 nM | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1561 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | B16P | ATAGGAGTCACGACGACCAGGGATGGGGCCGCGCGGGGTGGGGGCGCGAGGGCCGGCGGGTATGTGCGTCTACCTCTTGA | 80 | N/A | ssDNA | Cronobacter Sakazakii (CICC 21562) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | 49.83 ± 7.69 nM | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1562 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | B25P | ATAGGAGTCACGACGACCAGGCCGCCCGGGGACGGGGGCGGCGGGGAGGAGGGCGGCGGGTATGTGCGTCTACCTCTTGA | 80 | N/A | ssDNA | Cronobacter Sakazakii (CICC 21562) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1563 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A6 | GGGCAGGTGTTATGTGTACTGCTACAGTGTGGTTG | 35 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CICC 21484) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Show a linear range for monoaptasensor in the range of 1 × 10(1) to 1 × 10(9) CFU/mL and for polyaptasensor ranging from 1 × 10(1) to 1 × 10(7) CFU/mL with an LOD of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1564 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A16 | GGCAGGACAACAGCGTGTAGTATCAGCTTACGGTG | 35 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CICC 21484) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Show a linear range for monoaptasensor in the range of 1 × 10(1) to 1 × 10(9) CFU/mL and for polyaptasensor ranging from 1 × 10(1) to 1 × 10(7) CFU/mL with an LOD of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1565 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A18P | CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG | 35 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CICC 21484) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Show a linear range for monoaptasensor in the range of 1 × 10(1) to 1 × 10(9) CFU/mL and for polyaptasensor ranging from 1 × 10(1) to 1 × 10(7) CFU/mL with an LOD of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1566 | 34731314 | 2021 | An electrochemical aptasensor for Mycobacterium tuberculosis ESAT-6 antigen detection using bimetallic organic framework | EBA | GGGAGCTCAGAATAAACGCTCAACCTCCCTGGGTCACCATAGACTCCATCTAAGATGCTTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT-6 (6-kDa early secretory antigenic target) | A label-free electrochemical aptasensor was developed using NG@Zr-MOF-on-Ce-MOF@Tb nanohybrid for sensitive detection of ESAT-6. | Displayed a wide linear range from 100 fg/mL to 10 ng/mL with a limit of detection (LOD) of 12 fg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate (PO4(-3)) | N/A | The current remained at 95.77% and 88.72% of the initial current after storing at at 4℃ for 8 days and 16 days, respectively. | N/A | N/A | N/A |
| ABdb_1567 | 33780852 | 2021 | Microfluidic thread-based electrochemical aptasensor for rapid detection of Vibrio parahaemolyticus | Aptamer | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a thread-based microfluidic nano-aptasensor based on MoS2 modified threaded electrodes for V. parahaemolyticus detection. | The proposed aptasensor has a dynamic detection range of 10–10(6) CFU/mL, a detection limit of 5.74 CFU/mL, and an assay time of 30 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1568 | 33421762 | 2021 | Controllable design of a nano-bio aptasensing interface based on tetrahedral framework nucleic acids in an integrated microfluidic platform | Aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157: H7 (ATCC 43889) | Whole cell | Developed a tetrahedral framework nucleic acids-based aptasensing interface in the microfluidic system for E. coli O157: H7 detection and antimicrobial susceptibility testing (AST) determination. | A calibration curve was constructed over 10(1) to 10(5) CFU/mL, with a limit of detection of 10(1) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-CGGAATTCCG) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1569 | 33479797 | 2021 | A turn-on-type fluorescence resonance energy transfer aptasensor for vibrio detection using aptamer-modified polyhedral oligomeric silsesquioxane-perovskite quantum dots/Ti3C2 MXenes composite probes | VP aptamer | TTTTTTTTTCAACGAAACAGTGACTCGTTG | 30 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a turn-on–type aptasensor based on FRET pair using aptamer modified polyhedral oligomeric silsesquioxane-perovskite quantum dots (POSS-PQDs-Apt) as signal probe and titanium carbide (Ti3C2) MXenes as quencher for Vibrio parahaemolyticus (VP) determination. | Under optimized conditions, the assay can determine VP in the concentration range 10(2) - 10(6) cfu/mL with the detection limit (LOD) of 30 cfu/mL and 100 cfu/mL by naked eye in aquaculture water. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1570 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI05 | TAGCTCACTCATTAGGCACGACTCACTCTTGAAGGGGTGAGGCATGGTGGTATCAGCATAGTTAAGCCAGCC | 72 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 144.4 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1571 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI08 | TAGCTCACTCATTAGGCACATGCACCGAGGTCAGAAGTGCCTGTAATACACACCCCTCGGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 301.4 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1572 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI 9 | TAGCTCACTCATTAGGCACCGAGTGCAAGATGTCCTACCCGATGAAGTAGGTTGGGTCTGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 279.7 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1573 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI23 | TAGCTCACTCATTAGGCACCTTGGCTTAAAATGATAGCTAGTGGCAGATTGTTAATTTGGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | The assay is able to detect 10(2) CFU/mL cells. | 10 | Flow Cytometry | 231.2 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1574 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI27 | TAGCTCACTCATTAGGCACATGGCAAGGTTGCCTTTTTGAGCGCGCTGCATAGTTAAGCCAGCC | 64 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 328.9 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1575 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI31 | TAGCTCACTCATTAGGCACCAGCCGGAAGGACCAGCTAGCTCACTCATTAGGCACCGAAGTGTGGTGCATAGTTAAGCCAGCC | 83 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 186.1 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1576 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI37 | TAGCTCACTCATTAGGCACGAACGGGCTTGTCTTTCCATAATTCGTGCGAAAGTGCCGCATAGTTAAGCCAGCC | 74 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 176.7 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1577 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI42 | TAGCTCACTCATTAGGCACTAGCGGAAGCTTAGTGTAAACGAGTGATAATGTGTTATGTGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 173.6 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1578 | 33836431 | 2021 | Ultra-sensitive photoelectrochemical aptamer biosensor for detecting E. coli O157:H7 based on nonmetallic plasmonic two-dimensional hydrated defective tungsten oxide nanosheets coupling with nitrogen-doped graphene quantum dots (dWO3•H2O@N-GQDs) | E.coli O157:H7 aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed a novel PEC aptasensor based on dWO3•H2O@N-GQDs for ultrasensitive detection of E. coli O157:H7. | Achieved a limit of detection of 0.05 CFU/mL and a wide linear detection range from 0.1 to 10(4) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1579 | https://doi.org/10.1016/j.snb.2021.130337 | 2021 | Electrochemical aptasensor for simultaneous detection of foodborne pathogens based on a double stirring bars-assisted signal amplification strategy | Apt-V.P | TGGCTAGCTCAGTCATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTCCGCG | 60 | N/A | ssDNA | Vibrio Parahaemolyticus | Whole cell | Developed a double stirring bar-based signal-amplified strategy using aptamer-embedded tetrahedral DNA nanostructures for the simultaneous electrochemical detection of Vibrio parahaemolyticus (V.P) and Salmonella typhimurium (S.T). | Display a lower detection limit of 4 CFU/mL for V.P. within a detection range of 10–10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1580 | https://doi.org/10.1016/j.snb.2021.130337 | 2021 | Electrochemical aptasensor for simultaneous detection of foodborne pathogens based on a double stirring bars-assisted signal amplification strategy | Apt-S.T | TGGCTAGCTCAGTCATATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAGCCGCG | 60 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a double stirring bar-based signal-amplified strategy using aptamer-embedded tetrahedral DNA nanostructures for the simultaneous electrochemical detection of Vibrio parahaemolyticus (V.P) and Salmonella typhimurium (S.T). | Display a lower detection limit of 7 CFU/mL for S.T. within a detection range of 10–10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1581 | 33303152 | 2021 | Hollow carbon nanocapsules-based nitrogen-doped carbon nanofibers with rosary-like structure as a high surface substrate for impedimetric detection of Pseudomonas aeruginosa | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Developed an electrochemical aptasensor based on hollow carbon nanocapsule-based nitrogen-doped carbon nanofibers (CNCNF) with a rosary-like structure for the detection of PA. | The linear range and LOD of the aptasensor were 101-107 CFU/ml and 1 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | After 8 days of storage in Fe(CN)6 3-/4- at 4°C, the electrode was found to be 89% of its initial activity. | N/A | N/A | N/A |
| ABdb_1582 | https://doi.org/10.1016/j.microc.2021.106132 | 2021 | A novel photoelectrochemical aptamer sensor based on rare-earth doped Bi2WO6 and Ag2S for the rapid detection of Vibrio parahaemolyticus | Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a novel photoelectrochemical aptasensor based on rare-earth doped Bi2WO6 and Ag2S for the detection of V. parahaemolyticus. | Showed a wide linear range from 3.2 × 10(2) CFU/mL to 3.2 × 10(8) CFU/mL, and a detection limit of 40 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | After 2 weeks of storage at 4°C in a refrigerator, the biosensor retained 95% of its initial response. | N/A | N/A | N/A |
| ABdb_1583 | 34945447 | 2021 | A Novel Photoelectrochemical Aptamer Sensor Based on CdTe Quantum Dots Enhancement and Exonuclease I-Assisted Signal Amplification for Listeria monocytogenes Detection | Aptamer | ATACCAGCTTATTCAATTCCAAAAGCGCACCCATATATGTTCTATGTCCCCCACCTCGAGATTGCACTTACTATCT | 76 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Developed a photoelectrochemical aptasensor based on WO3, CdTe QDs, and Exo I auxiliary signal amplification for the detection of L. monocytogenes. | Showed a detection limit of 45 CFU/mL over the concentration range of 1.3 × 10(1) - 1.3 × 10 (7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1584 | 34053767 | 2021 | A novel smartphone-based colorimetric aptasensor for on-site detection of Escherichia coli O157:H7 in milk | Aptamer (Apt) | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | A colorimetric aptasensor was developed using GNP-Apt coupling with an MWCNT@CIP probe for detecting E. coli O157:H7 in milk. | Display a concentration of 8.43 × 10(3) cfu/mL in pure culture, and 5.24 × 10(2) cfu/mL in artificially contaminated milk after 1h. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (SH-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1585 | 34970724 | 2021 | Colorimetric determination of Listeria monocytogenes using aptamer and urease dual-labeled magnetic nanoparticles and cucurbit[7]uril-mediated supramolecular assembly of gold nanoparticle | Aptamer | TTTTTTTTTTATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 57 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19111) | Whole cell | Developed a colorimetric strategy using apt-MNP-urease conjugate for the detection of L. monocytogenes. | Achieved a concentration range from 10 to 10(6) cfu/mL, and the visual determination can be done down to 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1586 | 34074432 | 2021 | One-step colorimetric detection of Staphylococcus aureus based on target-induced shielding against the peroxidase mimicking activity of aptamer-functionalized gold-coated iron oxide nanocomposites | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a colorimetric sensor using apt-Fe3O4/Au nanocomposites for the detection of Staphylococcus aureus. | Display a linear range from 10 to 10(6) CFU/mL, with the visible limit of detection as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1587 | 33590378 | 2021 | Sensitive colorimetric aptasensor based on g-C3N4@Cu2O composites for detection of Salmonella typhimurium in food and water | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A colorimetric aptasensor using graphitic carbon nitride (g-C3N4) nanosheets and copper oxide(I) (Cu2O) nanocrystals was developed for detecting S. typhimurium. | Exhibited linear range from 1.5 × 10(1) to 1.5 × 10(5) CFU/ml, with a detection limit of 15 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1588 | 34753577 | 2021 | An efficient SERS platform for the ultrasensitive detection of Staphylococcus aureus and Listeria monocytogenes via wheat germ agglutinin-modified magnetic SERS substrate and streptavidin/aptamer co-functionalized SERS tags | S. aureus-aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptasensor using WGA modified-Fe3O4@Au MNPs and Streptavidin (SA)/aptamer co-functionalized SERS tags for S. aureus and L. mono detection. | The LOD for S. aureus was 3 cells/mL and a favorable linear relation (10-10(7) cells/mL). | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1589 | 34753577 | 2021 | An efficient SERS platform for the ultrasensitive detection of Staphylococcus aureus and Listeria monocytogenes via wheat germ agglutinin-modified magnetic SERS substrate and streptavidin/aptamer co-functionalized SERS tags | L. mono-aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes | Whole cell | Developed an aptasensor using WGA modified-Fe3O4@Au MNPs and Streptavidin (SA)/aptamer co-functionalized SERS tags for S. aureus and L. mono detection. | The LOD for L. mono was 5 cells/mL and a favorable linear relation (10-10(7) cells/mL). | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1590 | 33894956 | 2021 | A universal SERS-label immunoassay for pathogen bacteria detection based on Fe3O4@Au-aptamer separation and antibody-protein A orientation recognition | E. coli-aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 35150) | Staphylococcus aureus Protein A (SpA) | Developed a SERS aptasensor using aptamer-conjugated Fe3O4@Au magnetic nanoparticles (MNPs) and PA modified-SERS tags (Au@DTNB@PA) for the detection of bacteria. | The limit of detection (LOD) was 10 cells/mL for E. coli. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1591 | 33894956 | 2021 | A universal SERS-label immunoassay for pathogen bacteria detection based on Fe3O4@Au-aptamer separation and antibody-protein A orientation recognition | L. mono-aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Listeria Monocytogenes | Staphylococcus aureus Protein A (SpA) | Developed a SERS aptasensor using aptamer-conjugated Fe3O4@Au magnetic nanoparticles (MNPs) and PA modified-SERS tags (Au@DTNB@PA) for the detection of bacteria. | The limit of detection (LOD) was 10 cells/mL for L. mono. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1592 | 33894956 | 2021 | A universal SERS-label immunoassay for pathogen bacteria detection based on Fe3O4@Au-aptamer separation and antibody-protein A orientation recognition | S. typhi-aptamer | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Staphylococcus aureus Protein A (SpA) | Developed a SERS aptasensor using aptamer-conjugated Fe3O4@Au magnetic nanoparticles (MNPs) and PA modified-SERS tags (Au@DTNB@PA) for the detection of bacteria. | The limit of detection (LOD) for S. typhi was 25 cells/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1593 | 34041580 | 2021 | Fabrication of gold/silver nanodimer SERS probes for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an aptamer-facilitated gold/silver nanodimer SERS probe for the simultaneous detection of the two bacteria with the help of magnetic separation enrichment. | Achieved a linear range of 10(2) to 10(7) cfu/mL, with a detection limit of 50 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5′-SH-A-Cy3 and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1594 | 34041580 | 2021 | Fabrication of gold/silver nanodimer SERS probes for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptamer-facilitated gold/silver nanodimer SERS probe for the simultaneous detection of the two bacteria with the help of magnetic separation enrichment. | Achieved a linear range of 3.2 × 10(2) to 3.2 × 10(7) cfu/mL, with a detection limit of 96 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5′-SH-A-Rox and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1595 | 34869216 | 2021 | Electrochemical Biosensing Interface Based on Carbon Dots-Fe3O4 Nanomaterial for the Determination of Escherichia coli O157:H7 | Aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | A carbon dots-Fe3O4 nanomaterial (CDs-Fe3O4)-based electrochemical aptasensor for E. coli O157:H7 detection was developed. | Exhibited the detection range of 10–10(8) CFU/ml, and the detection limit of 6.88 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1596 | 34406747 | 2021 | Upconversion Nanoprobes Based on a Horseradish Peroxidase-Regulated Dual-Mode Strategy for the Ultrasensitive Detection of Staphylococcus aureus in Meat | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a colorimetric and fluorescent dual-mode nanoprobe using apt-MNPs and HRP-UCNPs-cDNA for the detection of S. aureus. | Obtained limits of detection of 22 CFU/mL for fluorescence and 20 CFU/mL for colorimetry in a linear range of 56–5.6 × 10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1597 | https://doi.org/10.1007/s13738-021-02384-9 | 2021 | Rapid and sensitive detection of Escherichia coli O157:H7 based on silver nanocluster fluorescent probe | E. coli O157:H7 aptamer | TGAGCCCAAGCCCTGGTATGCGGATAACGAGGTATTCACGACTGGTCGTCAGGTATGGTTGGCAGGTCTACTTTGGGATC | 80 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Detection of E. coli O157:H7 in food based on aptamer-modified silver nanocluster fluorescent probes. | The linear range was 10–10(6) CFU/mL, and the detection limit was 0.2549 CFU/mL in the buffer and 0.6031 CFU/mL in the milk simulation sample. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1598 | 10.33263/BRIAC112.87028715 | 2021 | Novel Competitive Voltammetric Aptasensor Based on Electrospun Carbon Nanofibers-Gold Nanoparticles Modified Graphite Electrode for Salmonella enterica serovar Detection | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an electrochemical aptasensor based on aptamer-linked GNPs/CNF-Chi/GEs for the detection of Salmonella enterica Serovar. | Exhibited a linear range of 10 to 10(5) CFU/mL with the limit of detection (LOD) 1.223 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1599 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E1 | TAGGGAAGAGAAGGACATATGA-CGATTACCGGAGCTGTGTCACCGGGCGCCAGTTGATGTGG-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1600 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E2 | TAGGGAAGAGAAGGACATATGA-TATGATGGGAGTAACGATTGTCCGACATGGTACCACCCCA-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1601 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E3 | TAGGGAAGAGAAGGACATATGA-GGTGCACCTCTCGCCCGAATCAGATCCCCACGGCGCCCCCTA-TTGACTAGTACATGACCACTTGA | 87 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1602 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E4 | TAGGGAAGAGAAGGACATATGA-ATCGGCTACGAGGTCCCGACTGCCGGACTGGCCCTTGGTC-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1603 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E5 | TAGGGAAGAGAAGGACATATGA-ACACCGCCACGATGCAACTGCCAAACGCACCGTACGCCTG-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1604 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E6 | TAGGGAAGAGAAGGACATATGA-CGAGAGGCCGCTGGGTCTAGACGTCCGGGTGCCACTCGCG-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1605 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E7 | TAGGGAAGAGAAGGACATATGA-TAACGCCTGTAGTACTCCACCTTAATCCGTTGCCAGGAAT-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1606 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E8 | TAGGGAAGAGAAGGACATATGA-CATTCTGCACCGCCATCAGTCTTTCTTCGATACCGCGTTT-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | The limit of detection observed visually was 10(2) cells/mL with GO coating and 10(3) cells/mL without GO. The detection limit in real-time coconut water samples was also 10(2) cells/mL. | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | 15.90 ± 3.07 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled, 5'-Thiolated and 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2122 | 33367418 | 2021 | Photo-responsive functional gold nanocapsules for inactivation of community-acquired, highly virulent, multidrug-resistant MRSA | Aptamer | N/A | N/A | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) “superbug” (USA300) | Whole cell | Aptamers functionalization of Cur@mPEG-SH@GNRs for PTT and ROS. | Blocked biofilm formation and killed all of the trapped bacteria in 30 min during NIR stimulation. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2123 | 33395571 | 2021 | Aptasensor for the detection of Methicillin resistant Staphylococcus aureus on contaminated surfaces | AT0033 | N/A | N/A | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 25923) | Penicillin binding protein 2a (PBP2a) | Developed a colorimetric aptasensor for the detection of MRSA on contaminated surfaces. | The visual detection limit was less than 100 CFU/ml and, theoretically, 2 CFU/ml, while the linear range of quantitation was 10(2)–10(5) CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_2124 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-1 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) are used to develop a triple-module biosensor to capture H. pylori. | Exhibited a wide detection range of 10-10(7) CFU/mL and a limit of detection (LOD) as low as 1 CFU/mL. | 10 | Fluorescence Spectroscopy | 36.91 ± 11.1 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2125 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-2 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori. | N/A | 10 | Fluorescence Spectroscopy | 46.31 ± 11.31 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2126 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-3 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori. | N/A | 10 | Fluorescence Spectroscopy | 60.76 ± 11.69 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2127 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-4 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori. | N/A | 10 | Fluorescence Spectroscopy | 41.57 ± 16.18 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2128 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-5 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori. | N/A | 10 | Fluorescence Spectroscopy | 67.74 ± 10.24 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |