Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 154
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1349 | 31953175 | 2020 | Single-stranded DNA (ssDNA) Aptamer targeting SipA protein inhibits Salmonella Enteritidis invasion of intestinal epithelial cells | Apt17 | TAGGGAAGAGAAGGACATATGAT-GCAATGGAACCGCTGAACGACCCTAGCATTATCAGTGTGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) TM 6 andTM 68 | SipA protein | Identify an aptamer targeting the SipA protein and interfere with the function of effector proteins to prevent host cell invasion. | 70% and 37.7% inhibition ratios against adhesion and invasion of S. enteritidis TM 6 to Caco-2 cells, 45.71% and 39.5% against those of S. enteritidis TM 68, respectively. | 9 | Fluorescence Spectroscopy | 114.9 nM (at 27°C) and 63.4nM (at 37°C) | Therapeutics | Magnetic Bead (MB)-based SELEX | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1350 | 32333113 | 2020 | Inhibitory effects of aptamer targeted teicoplanin encapsulated PLGA nanoparticles for Staphylococcus aureus strains | SA20 | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) susceptible strains and MRSA | Whole cell | Aptamer-PLGA nanoparticles (Apt-teicoplanin-PLGA NPs) for the delivery of teicoplanin antibiotic. | MICs of teicoplanin decreased by 32- and 64-fold for susceptible strains and MRSA strains, respectively. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1351 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 10 colony 5 | CCGGAATTCCTAATACGACTCTACAAAAAGTCGTGGTCCAGTTGCCATGTGTAAAACTGTGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | Exhibited the highest biofilm inhibition towards EPEC K1.1 shown by lowest OD value of 0.126. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1352 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 1 | CCGGAATTCCTAATACGACTCTGCGGACTGTATGCGGTACGGTCGAAAATAGTGAAGGTGCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1353 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 4 | CCGGAATTCCTAATACGACTCACTACGCACGGCGCGAGTAAATCGATCATGGTACTGTGGCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1354 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 7 | CCGGAATTCCTAATACGACTCGGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1355 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 9 colony 3 | CCGGAATTCCTAATACGACTCGAAAACGTACCACTGGGATGGGTTGTGGGAGAGGGCCAGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1356 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 10 colony 10 | CCGGAATTCCTAATACGACTCATCCAGCAGATGTGCGCGGGTTGGTGGGGGAACGGTGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1357 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20–5 | GCAATGGTACGGTACTTCC-ATTTCGCCCCCGTGTTCCGACTGGTATCTTCACGTCTTCGAGTGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 3.9 ± 0.6 nM | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1358 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20–7 | GCAATGGTACGGTACTTCC-CGCAATACCAAAGTGGCGAGAGCGCTGTCTTGAGTGAGTGGTTGG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 8 ± 0.9 nM | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1359 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20–10 | GCAATGGTACGGTACTTCC-TATGGCGTGGCAAGCTTGGCCCGCTTCTCAAGCATGGTTATCTAC-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 10.1 ± 1.7 nM | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1360 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-1 | GCAATGGTACGGTACTTCC-GATTAGCTACATTTGGTTGTTTACCGCTCTGCTTTCTATTATTT-CAAAAGTGCACGCTACTTTGCTAA | 87 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1361 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-2 | GCAATGGTACGGTACTTCC-TGTTAGTGTTTAAGGCCCAAAGTCGGTTCATCAGTACATTCCTCG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1362 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-3 | GCAATGGTACGGTACTTCC-TTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAA-CAAAAGTGCACGCTACTTTGCTAA | 85 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1363 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-4 | GCAATGGTACGGTACTTCC-GATTGTGGTGGGGCCTCGAGATACCTGCGACCGGCATACTTGAAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1364 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-6 | GCAATGGTACGGTACTTCC-TTGCCCGTACACTGTCATCCTCGGCTTATAGCCATTATTGAAATT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1365 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-8 | GCAATGGTACGGTACTTCC-GGGCCTATACAGGCTTTTACTTCTGAGTTTGGTAGTTTCTTCGGA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1366 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-9 | GCAATGGTACGGTACTTCC-GCGAGGGCCAACGGTGGTTACGTCGCTACGGCGCTACTGGTTGAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1367 | 32499557 | 2020 | Identification of two aptamers binding to Legionella pneumophila with high affinity and specificity | R10C5 | GCAATGGTACGGTACTTCCGGACAGTGCTGAAAACTGTGACCCCCCAAAAGTGCACGCTACTTTGCTAA | 69 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Legionella Pneumophila (Lp 120292) | Whole cell | Identify an aptamer against Lp and utilise it as a biorecognition element in a biosensor to detect Lp in real-time and in situ. | Around 60% of lp120292 cells are stained by R10C5 and 20% of Pseudomonas strains. | 10 | Flow Cytometry | 116 nM | Biosensor | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent application no US 16/850,355 |
| ABdb_1368 | 32499557 | 2020 | Identification of two aptamers binding to Legionella pneumophila with high affinity and specificity | R10C1 | GCAATGGTACGGTACTTCCCCACCCCACGCTGCTCCCAAAAGTGCACGCTACTTTGCTAA | 60 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Legionella Pneumophila (Lp 120292) | Whole cell | Identify an aptamer against Lp and utilise it as a biorecognition element in a biosensor to detect Lp in real-time and in situ. | R10C1 shows significantly more binding to Lp than to Pseudomonas. | 10 | Flow Cytometry | 135 nM | Biosensor | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent application no US 16/850,355 |
| ABdb_1369 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 1 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (U433, U556-ESBL, B12327, U5307, U6267-ESBL) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1370 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 2 | TACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCTACTGT | 43 | N/A | ssDNA | Acinetobacter Baumannii (P762, T800, R4197, R4299, R4356) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1371 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 3 | N/A | N/A | 5'-GCAATGGTACGGTACTTCC-(N45)-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Klebsiella Pneumoniae (PAE1, PAE2, PAE3, PAE4, PAE5) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1372 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 4 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (KP1-ESBL, KP2-ESBL, KP3, KP4-ESBL, KP5-ESBL) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1373 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 5 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (P101, T82, C970, R4308, R4319) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1374 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 6 | ATCCAGAGTGACGCAGCACGACACGTTAGGTTGGTTAGGTTGGTTAGTTTCTTGTGGACACGGTGGCTTA | 70 | N/A | ssDNA | Enterococcus Faecalis (R1238, U554, U5179, U4879, U5064) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1375 | 32451800 | 2020 | Inhibition of Salmonella enteritidis biofilms by Salmonella invasion protein-targeting aptamer | Apt17 | TAGGGAAGAGAAGGACATATGAT-GCAATGGAACCGCTGAACGACCCTAGCATTATCAGTGTGG-TTGACTAGTACATGACCACTTGA | 86 | N/A | ssDNA | Salmonella Enteritidis (S. Enteritidis) TM 6 andTM 68 | Salmonella invasion proteinA (SipA) | An aptamer targets the SipA protein to inhibit Salmonella biofilm formation by interfering with the T3SS. | Co-incubation of Apt17 with ampicillin MIC/10 for 24 h inhibited the biofilms of S. enteritidis TM 6 and S. enteritidis TM 68 by 12.5% and 20.9% respectively. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1376 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC1 | TACTTCCGCACCCTCCTACA | 20 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1377 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC2 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1378 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC3 | CCCTTTCCCTTTCCCATTCCCGTTCCCTTTCCCTTTCCCATTCCCGTTA | 49 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1379 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC5 | ATGAGAGCGTCGGTGTGGTA-CCCTTTCCCTTTCCCATTCCCGTTCCCTTTCCCTTTCCCATTCCCGTTA-TACTTCCGCACCCTCCTACA | 89 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1380 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC6 | ATGAGAGCGTCGGTGTGGTA | 20 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1381 | 32289369 | 2020 | Accurate MRSA identification through dual-functional aptamer and CRISPR-Cas12a assisted rolling circle amplification | Apt A | ATATACACCCCACCTCGCTCCCGTGACACTAATGCTATTTTTT | 43 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 17802) | Staphylococcus aureus Protein A (SpA) | Dual-functional technology based on aptamer and CRISPR-Cas12a-assisted RCA for detection of MRSA. | Fluorescence intensity shows a linear correlation with the logarithm of MRSA concentration, ranging from 10(6) to 10(2) CFU/mL, spanning six orders of magnitude. | N/A | N/A | N/A | Detection | N/A | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1382 | 32289369 | 2020 | Accurate MRSA identification through dual-functional aptamer and CRISPR-Cas12a assisted rolling circle amplification | Apt B | CACCCCACCTCGCTCCCGTGACACTAATGCTATTTTTT | 38 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 17802) | Penicillin binding protein 2a (PBP2a) | Dual-functional technology based on aptamer and CRISPR-Cas12a-assisted RCA for detection of MRSA. | Fluorescence intensity shows a linear correlation with the logarithm of MRSA concentration, ranging from 10(6) to 10(2) CFU/mL, spanning six orders of magnitude. | N/A | N/A | N/A | Detection | N/A | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1383 | 32291246 | 2020 | Dual aptamer assay for detection of Acinetobacter baumannii on an electromagnetically-driven microfluidic platform | Aptamer | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | Dual aptamer assay to diagnose AB by using an electromagnetically-driven microfluidic system. | Within 30 minutes, a limit of detection of only 100 CFU/reaction and a range of 10^2 to 10^5 CFU/reaction was obtained. | N/A | N/A | 6.8 ± 1.9 nM | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1384 | 32993865 | 2020 | A universal signal-on electrochemical assay for rapid on-site quantitation of vibrio parahaemolyticus using aptamer modified magnetic metal-organic framework and phenylboronic acid-ferrocene co-immobilized nanolabel | Aptamer | TTTTTTTTTCAACGAAACAGTGACTCGTTG | 30 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a signal-on type electrochemical aptasensor (Fe3O4@NMOF-Apt) to rapidly and on-site detect V.P. | Detects V.P in the range of 10–10(9) cfu/mL with an LOD of 3 cfu/mL and within only 20 min. | N/A | Linearized adsorption isotherm | 16.8 nM (with V.P.) and 2.2 ± 0.2 nM (with Fe3O4@NMOF-Apt) | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | No significant difference in the measured blank and signals was observed over 3 months with aptasensor, when 91.3% of the initial signal was obtained. | N/A | N/A | N/A |
| ABdb_1385 | 32905329 | 2020 | Simple Colorimetric Assay for Vibrio parahaemolyticus Detection Using Aptamer-Functionalized Nanoparticles | V.P. Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a visual colorimetric assay using aptamer-conjugated MNPs and AuNPs for the detection of V. parahaemolyticus. | Shows a linear range of 10-10(6) cfu/mL, with a limit of detection of 2.4 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1386 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF501 | TAGGGAAGAGAAGGACATATGAT-TTTCTCAACGGGACCATCACTTACCTCAAGTACTTGGACG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1387 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF502 | TAGGGAAGAGAAGGACATATGAT-CCGGCTATCTCCCTACCGTGGCCGAGTACCTCAAACGTTT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1388 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF503 | TAGGGAAGAGAAGGACATATGAT-GTCAACTCATTTATGGTGCTCCTCGTACCTCAGGTGGTTA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1389 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF504 | TAGGGAAGAGAAGGACATATGAT-GGCCATACCTCGTGCCTTCTGTGATCATCTCTATCAATTG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1390 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF505 | TAGGGAAGAGAAGGACATATGAT-CCTCTCTCTTACTGCTACTGGGCAGGGTACTCAATTACGT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1391 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF506 | TAGGGAAGAGAAGGACATATGAT-CGGTCCCGACTCAATATTGTTCCCTCCCCTTATCAGGCGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1392 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF507 | TAGGGAAGAGAAGGACATATGAT-TCCTCTAATCAACTCTATGCCTTATCCCCTTGGTCAGGAC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1393 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF508 | TAGGGAAGAGAAGGACATATGAT-ACTGGCCTTGACACCCTGTTGTGGCTTGATGACAATAACA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | EF508 exhibited more than 20- to 800-fold higher binding to E. faecalis target cells than to non-target cells. | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 37 ± 4 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1394 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF509 | TAGGGAAGAGAAGGACATATGAT-CCTCACTCTTGACCCAAAGTGCATGCTCTATTCATTCGGA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1395 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF510 | TAGGGAAGAGAAGGACATATGAT-GCTTCTGTGCACATTAAGGCACTCGTCTTCACTGTGGTTC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1396 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF511 | TAGGGAAGAGAAGGACATATGAT-CCTAACTCACTTACCAGCACGAGGTGCCTGTACCATCAAT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1397 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF512 | TAGGGAAGAGAAGGACATATGAT-CTCTCATCACAGGAATTTGAATTTCCCTTGTGGACAGTAA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1398 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF513 | TAGGGAAGAGAAGGACATATGAT-GATGTGAATTCCGTCCCTTGGTCAGACACTTCAACACCGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1399 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF514 | TAGGGAAGAGAAGGACATATGAT-TCTCGACGCTATGATCAAGACGCAGTATGATGGCACATCA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1400 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF515 | TAGGGAAGAGAAGGACATATGAT-TTAACCCTCATTTAATGGCCGCGTCAATCCGCAAAGGGTC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1401 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF516 | TAGGGAAGAGAAGGACATATGAT-TTCCTTCGCAGGACACCGATGGCCAGGCGCGAGTCAATAT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1402 | 32037808 | 2020 | Gold Nanobones Enhanced Ultrasensitive Surface-Enhanced Raman Scattering Aptasensor for Detecting Escherichia coli O157:H7 | Apt-1 | AAAAAAAAAAAAAAAAAAAACCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 62 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Developed a one-pot step method based on capture probe (MNPs + Apt-2) and the signal probe (GNR(Apt‑1+RhB)) for SERS detection of E. coli O157:H7. | Exhibited a linear range of 10-10,000 cfu/mL with a limit of detection of 3 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1403 | 32037808 | 2020 | Gold Nanobones Enhanced Ultrasensitive Surface-Enhanced Raman Scattering Aptasensor for Detecting Escherichia coli O157:H7 | Apt-2 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Developed a one-pot step method based on capture probe (MNPs + Apt-2) and the signal probe (GNR(Apt‑1+RhB)) for SERS detection of E. coli O157:H7. | Exhibited a linear range of 10-10,000 cfu/mL with a limit of detection of 3 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1404 | 32685985 | 2020 | Electrochemical aptasensor using boron-carbon nanorods decorated by nickel nanoparticles for detection of E. coli O157:H7 | Anti-E. coli O157:H7 aptamer | ATCCAGAGTGACGCAGCA-GGGTGGCGAGACTGGGCGGGTGTCGGGAAGTGAACCGGTGGCGTG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed a label-free impedimetric aptasensor for the detection of E. coli O157:H7 employing boron-carbon nanorods decorated by nickel nanoparticles (BC-Ni) nanostructured platform. | Detect E. coli O157:H7 selectively with a detection limit of 10 cfu and a dynamic detection range of 10(0) to 10(5) cfu in water, juice, and faecal samples. | 15 | Bio-Layer Interferometry (BLI) | 69.73 nM | Biosensor | Microtiter Plate-based Cell SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1405 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 1 | ATTAGTCAAGAGGTAGACGCACATAAGGGGTCTGGTGTCGGGCCGCGGGTCAGGGGGGTAAGGGATTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | The detection limit was 10 CFU/mL within 15 min with no cross-reactivity with other bacterial species. | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1406 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 2 | ATTAGTCAAGAGGTAGACGCACATAAGGAGTCACGACGACCAGAAACGTTTGCGGTGTTGAGCGGTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | The detection limit was 10(3) CFU/mL. | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1407 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 3 | ATTAGTCAAGAGGTAGACGCACATAACGGCGGCAGCGAGGGCGAACCAGGGGGGGCACACCGAGCTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | N/A | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1408 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 4 | ATTAGTCAAGAGGTAGACGCACATAAGTATTTAGCGAACTCGCGGAGGTTCAGTAAAGAATGTACTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | N/A | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1409 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 5 | ATTAGTCAAGAGGTAGACGCACATAGCCACTCGACCCGCCAGAAACGGCGACAGGATGGCCGCGGTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | N/A | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1410 | https://doi.org/10.1007/s12161-020-01821-4 | 2020 | Fluorescent Turn-on Aptasensor of Staphylococcus aureus Based on the FRET Between Green Carbon Quantum Dot and Gold Nanoparticle | Staphylococcus aureus aptamer | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed FRET-based aptasensor with CQDs and GNPs for the detection of S. aureus. | Linear detection range of 10⁸ to 10¹ CFU/mL with a detection limit (LOD) of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1411 | 32892935 | 2020 | Naked-eye based point-of-care detection of E.coli O157: H7 by a signal-amplified microfluidic aptasensor | Anti-E.coli O157: H7 aptamer | ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (BNCC 191201) | Whole cell | Developed an eye-based aptasensor (EA-Sensor) for the detection of E.coli O157:H7. | Display a linear range of 500–5 × 10(7) CFU/mL and LOD of 250 CFU/mL and 400 CFU/mL for buffered and milk samples. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1412 | https://doi.org/10.1111/jfs.12868 | 2020 | Ultrasensitive detection of Listeria monocytogenes using solid-state electrochemiluminescence biosensing based on the quenching effect of ferrocene on ruthenium pyridine | Aptamer (ssDNA) | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115, Serotype 4 b) | Whole cell | Developed an ECL biosensing switch system based on the specific recognition of an aptamer and the destruction of pyridine ruthenium by ferrocene for the detection of L. monocytogenes. | Produced a good linear relationship over the concentration range of 1.4 × 10(1)–1.4 × 10(6) CFU/ml and a detection limit of 4 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1413 | https://doi.org/10.3390/IECB2020-07079 | 2020 | Detection of Listeria innocua by Acoustic Aptasensor | Aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Innocua | Whole cell | QCM-based aptasensor for the detection of pathogenic bacteria Listeria innocua. | The achieved limit of detection was approximately 1.6 × 10(3) CFU/mL and broad range of 5 × 10(3)-10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1414 | https://doi.org/10.1016/j.foodcont.2020.107808 | 2020 | Development of a fluorescence aptasensor for rapid and sensitive detection of Listeria monocytogenes in food | L. monocytogenes Aptamer | GGGAGCTCAGAATAAACGCTCAATACTATCGCGGGACAGCGCGGGAGGCACCGGGGATTCGACATGAGGCCCGGATC | 77 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | A fluorescence aptasensor based on aptamer-UCNP and aptamer-MNP complex was developed for the detection of L. monocytogenes. | A low limit of detection of 8 cfu/mL was estimated from the range of 68 to 68 × 10(6) cfu/mL. | N/A | N/A | 48.74 ± 3.11 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1415 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V8 | AGTATACGTATTACCTGCAGC-CAATCATGACCGCCCACCTCACTCG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell (Cell wall protein) | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | The LOD of the V8 from cytometry is 29.96 CFU/mL, and the linear range is 102–5 × 105 CFU/mL. | 13 | Flow Cytometry | 11.22 ± 1.30 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | V8 and V13 can tolerate diluted serum as well as oyster infusion. | Best Candidate | N/A | N/A |
| ABdb_1416 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V9 | AGTATACGTATTACCTGCAGC-CCTGGACATCATTGAGTACTCGTCT-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1417 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V11 | AGTATACGTATTACCTGCAGC-TCCCAACCAATACCAGTACGTTGTA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1418 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V12 | AGTATACGTATTACCTGCAGC-TATGGATTTGCGTCATGTTTATGTG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1419 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V13 | AGTATACGTATTACCTGCAGC-CCAACCCTATGCTTCAACGGTCTTT-GCAAAGATCTCCGAGATATCG | 67 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | 15.47 ± 0.39 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | V8 and V13 can tolerate diluted serum as well as oyster infusion. | Best Candidate | N/A | N/A |
| ABdb_1420 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V18 | AGTATACGTATTACCTGCAGC-TGTGGGTGGGTGGGTGGTATCTGCA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1421 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V20 | AGTATACGTATTACCTGCAGC-CATCCCCTCTCCTGTTGCCCTGACA-GCAAAGATCTCCGAGATATCG | 67 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1422 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V28 | AGTATACGTATTACCTGCAGC-CCTGGACATCATTGAGTACTCGTCT-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1423 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V31 | AGTATACGTATTACCTGCAGC-TGTGGGTGGGATTAGGTTCGGGTGG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1424 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V38 | AGTATACGTATTACCTGCAGC-CCAGACTTCAATCGCGTCAACCGTT-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1425 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V39 | AGTATACGTATTACCTGCAGC-TGATGGTTGTATGACTGGATGTCAA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1426 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V40 | AGTATACGTATTACCTGCAGC-TCCCCTTTGCATGGCGGTGACACTG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1427 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V41 | AGTATACGTATTACCTGCAGC-CACCTAGAACACATTGCAACATTAG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1428 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V44 | AGTATACGTATTACCTGCAGC-TGCTCCTCGACTGTTGTTAATCGTG-GCAGATCTCCGAGATATCG | 65 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1429 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V49 | AGTATACGTATTACCTGCAGC-TGACATCGTCTGACCTCCACAAGCA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1430 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V53 | AGTATACGTATTACCTGCAGC-TGGGTCCGTATGTTGGTGTATGTGA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1431 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V59 | AGTATACGTATTACCTGCAGC-TGTATACCCGACCGTACCGACGTAA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1432 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V69 | AGTATACGTATTACCTGCAGC-TCACCTTCACACACTCCCTTCTTCG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1433 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V71 | AGTATACGTATTACCTGCAGC-CCTGTACAAGCAGTATGTCAGCTGA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1434 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | TV8 | CAATCATGACCGCCCACCTCACTCG | 25 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | The fluorescent intensity of V. vulnificus was significantly greater than that of other species. | 13 | Flow Cytometry | 17.44 ± 1.30 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1435 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | TV13 | CCAACCCTATGCTTCAACGGTCTTT | 25 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | The fluorescent intensity of V. vulnificus was significantly greater than that of other species. | 13 | Flow Cytometry | 13.21 ± 2.19 nm | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1436 | 32350613 | 2020 | A fluorescent aptasensor for Staphylococcus aureus based on strand displacement amplification and self-assembled DNA hexagonal structure | Aptamer | CACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT | 48 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A fluorescent aptasensor based on MB-apt-cDNA duplex for S. aureus in milk samples. | Exhibits a broad linear range from 7 to 7 × 10(7) CFU/mL, with a detection limit of 1.7 CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1437 | 32594319 | 2020 | SiC-functionalized fluorescent aptasensor for determination of Proteus mirabilis | Aptamer | TTGCTGTAGGGGAGGAGGGTGGGT | 24 | N/A | ssDNA | Proteus Mirabilis (ATCC 12453) | Whole cell | Developed a fluorescent aptasensor based on aptamer-modified SiC quantum dots (DNA-SiC QDs) for the determination of Proteus mirabilis. | The linear range is from 10(3) to 10(8) CFU/mL, and the limit of detection is 526 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1438 | 32070611 | 2020 | Rapid and sensitive detection of Salmonella Typhimurium using nickel nanowire bridge for electrochemical impedance amplification | Aptamer | CAGTCCAGGACAGATTCGCGAGCCCACTCCAAACACGACCAACTCACGCTCTATCAACATCGCTATCCACGTGGATTTCATTCAGCGATT | 90 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an electrochemical aptasensor using an aptamer-coated gold interdigitated microelectrode and antibody-modified NiNWs to detect Salmonella typhimurium. | This electrochemical aptasensor quantitatively detected Salmonella at concentrations ranging from 10(2) to 10(6) CFU/mL within 2 h, with a detection limit of 80 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1439 | 31726272 | 2020 | CdS quantum dots/Au nanoparticles/ZnO nanowire array for self-powered photoelectrochemical detection of Escherichia coli O157:H7 | E. coli aptamer | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Surface protein | Developed a photoelectrochemical (PEC) platform (CdS QDs/Au NPs/ZnO NWs) for the detection of E. coli O157:H7. | Exhibited a wide linear range of 10-10(7) CFU/mL with the detection limit as low as 1.125 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | After 15 days, the PEC aptasensor still retained 87% of its initial sensitivity. | N/A | N/A | N/A |
| ABdb_1440 | 31655050 | 2020 | Rapid and sensitive detection of Salmonella with reduced graphene oxide-carbon nanotube based electrochemical aptasensor | S. Typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Develop a biosensor using reduced graphene oxide-carbon nanotubes (rGO-CNT) nanocomposite via the hydrothermal method for label-free electrochemical detection of S. enterica. | Display a wide linear dynamic range from 10(1) until 10(8) cfu/mL with a 10(1) cfu/mL of the limit of detection. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | ssDNA/rGO-CNT/GCE aptasensor showed good to excellent stability when stored for 20 days in ultrapure water at 4°C. | N/A | N/A | N/A |
| ABdb_1441 | 32471128 | 2020 | Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture | A15-1 | GTGGGGTTGAAAACGCCGGAGAGGGTGTGTGGGTGGGGTA | 40 | N/A | ssDNA | Mycoplasma Hyorhinis | Mycoplasma hyorhinis-infected cells | Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines. | A15-1 could bind to M. hyorhinis, and mixed mycoplasma-infected cells were detectable within 30 min. | N/A | Flow Cytometry | N/A | Detection | N/A | 5'-Biotinylated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1442 | 32471128 | 2020 | Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture | A16-1Y | TGGGTGGGGTTGTCGCTAGGGGTTTAAGGGGTCGTCGTGA | 40 | N/A | ssDNA | Mycoplasma Hyorhinis | Mycoplasma hyorhinis-infected cells | Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines. | A16-1Y could bind to M. hyorhinis and mixed mycoplasma-infected cells. | N/A | Flow Cytometry | N/A | Detection | N/A | 5'-Biotinylated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1443 | 32471128 | 2020 | Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture | #1J | ATCCAGAGTGACGCAGCAGCCAACGTGCTTTCTACCTTATTTTCCGTCACTCTCACTCTGGACACGGTGGCTTAGT | 76 | N/A | ssDNA | Mycoplasma Hyorhinis | Mycoplasma hyorhinis-infected cells | Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines. | #1J could bind to unclassified mycoplasma-infected cells, but not M. hyorhinis-infected cells. | N/A | Flow Cytometry | N/A | Detection | N/A | 5'-Biotinylated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1444 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.01 (ID 5) | TTTTTAAGCCCACAGACGWYCGGCAGGCACAGTYYGTCAAGGXCGYGCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | W = indole‐dU,Y = phenol‐dU,X = amine‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1445 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.02 (ID 6) | TTTTTAAGCCCACCYCGCYGTGCAAGGCGAACGCCATCAGTGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1446 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.03 (ID 7) | TTTTTAAGCCCACCYCCGWYCGAAGGCCACAGCYCATGCGCGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU,W = indole‐dU, five additional Ts at the 5'-end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1447 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.04 (ID 8) | TTTTTAACACGACCCCACYGTGCGAGCCGAACACCACCACGGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1448 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.05 (ID 9) | TTTTTAACACGACXYAGCYGTGWGGGCCGAACACCAGGCACGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | X = amine‐dU,Y = phenol‐dU, five additional Ts at the 5'‐end, and CCATG at the 3′‐end, five additional Ts at the 5′‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1449 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.06 (ID 12) | TTTTTAACACGACAGCAGWYCGGCGGGCACAGTGCGTGCGAGXCGYGCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | Aptamer ID 12 showed specific binding to Vp. | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | W = indole‐dU,Y = phenol‐dU,X = amine‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1450 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.07 (ID 13) | TTTTTAACACGACCAWACYGTGGCAGACGAACGCCGTCACAGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU,W = indole‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1451 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.08 (ID 14) | TTTTTAAGCCCACGCGGCYGTGAGXCGCACAGCCAWAGCACGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | W = indole‐dU,Y = phenol‐dU,X = amine‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1452 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.09 (ID 15) | GCCCACTGAACTGTGGCGGGCACAGGATGTGGAAGTGGGC | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1453 | 34567619 | 2020 | An aptamer-based shear horizontal surface acoustic wave biosensor with a CVD-grown single-layered graphene film for high-sensitivity detection of a label-free endotoxin | Aptamer | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | N/A | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Endotoxin (Lipopolysaccharide (LPS)) | Developed SH-SAW biosensor with chemical vapour deposition (CVD)-grown single-layered graphene (SLG) for endotoxin detection. | The biosensor exhibited a linear detection range of 0-100 ng/mL and a detection limit (LOD) of 3.53 ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1454 | 33241794 | 2020 | Rapid and highly sensitive detection of Salmonella typhimurium in lettuce by using magnetic fluorescent nanoparticles | S. typhimurium aptamer | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Outer membrane protein (OMP) | Develop a fluorescent sensor (FMNCs-Apt), based on Fe3O4 magnetic nanoparticles and aptamer-modified carbon quantum dots for the detection of S. typhimurium in lettuce. | Detection limit (LOD) of 100 CFU/mL in vegetable washing solution and 138 CFU/mL in lettuce samples with a linear range of 10(3)-10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1455 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C1R1 | TAGGGAAGAGAAGGACATATGAT-GCGCGCGAGATTAACCCCCCAATGCTGCACCGAGCCACGA-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | With 250 cells as the lowest measured cell number by the C1R1. The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | 31 ± 2 nM | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1456 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C2R1 | TAGGGAAGAGAAGGACATATGAT-GCGGCAGGGAAGGACTATGTGGGTGAAAGGAGTGCGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1457 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C2R2 | TAGGGAAGAGAAGGACATATGAT-GCAGCGGGATGGGGTAAATGGTGGCGAGAGGCGTCGGGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1458 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C4R2 | TAGGGAAGAGAAGGACATATGAT-GCGGGTTGACTAGTACATGACCACTTGAGTCGCTTGAACT-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | Labelling efficiency by C4R2 of approximately 60 % fluorescence signal relative to R16 values. The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1459 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C6R3 | TAGGGAAGAGAAGGACATATGAT-GCGGGGAGAGGCGAAAGAAGCTGGGATGGAAGGGCGTAGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1460 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C10R5 | TAGGGAAGAGAAGGACATATGAT-GCAGCCACAGCAGAGACGGGAAGGGCCAGGGTTGAGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1461 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C10R6 | TAGGGAAGAGAAGGACATATGAT-GCGGCGGTGGGGCTTTCGGTGATTTGGGCGGTTTGGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1462 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA1 | CTGCGATCAAGTTACGCACCTCGCCATGTTCCCCGCCCGGCATGTGTTATGCCCCTGTG | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | C. jejuni can be detected from 1.7 × 10(1) to 1.7 × 10(6) CFU/mL. The limit of detection (LOD) is obtained as 10 CFU/mL in PBS and 13 CFU/mL in contaminated milk samples. | 12 | Fluorescence Binding Assay | 1.37 ± 0.28 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1463 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA2 | GTTGGGTGCGGCGGGAGGGTCCCATCGGAAACCAAGCTGTGCTGAGATTTTTCCGCGAT | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 1.78 ± 0.88 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1464 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA3 | CACGCAAGTTAATCAGCGTGACATCAGGTCTAGATTCCGGCTTATAGCGCCAGGTTTCC | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 2.01 ± 0.90 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1465 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA4 | GGTGGGCTCTGTTCGGGAGGGGTATTGTTAGGACCGAGAGGCTGCATTCCGCCAGCTGC | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 2.26 ± 0.91 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1466 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA5 | GCTCTGTCTTTTCAGCTTTATCCGGGTGTGGTGGGGGGGGGATTTGCTTGGTCGGTTCT | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 3.53 ± 1.38 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1467 | 32980107 | 2020 | A novel method combining aptamer-Ag10NPs based microfluidic biochip with bright field imaging for detection of KPC-2-expressing bacteria | XK10 | GGCAGGACACCGTAACGGGTATGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTGCTGCT | 61 | N/A | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Developed a PDMS/glass microfluidic biochip integrated with aptamer-modified Ag(10)NPs nano-biosensors to detect whether bacteria express KPC-2. | Detects the target bacterium with a detection limit of 10(2) CFU and a capture efficiency exceeding 90% in ∼1 h. | 8 | Surface Plasmon Resonance (SPR) | 0.81 nM | Biosensor | Protein SELEX and Whole Cell-SELEX | 5'-Biotinylated and 5′-Thiolated (SH-AAAAA) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1468 | 32095939 | 2020 | A fluorometric assay for rapid enrichment and determination of bacteria by using zirconium-metal organic frameworks as both capture surface and signal amplification tag | Ab-Apt | TACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCTACTGT | 43 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | A fluorometric assay was developed to determine A. baumannii in blood samples by utilizing Zr-MOFs as capture probe (denoted as Zr-mMOF-p-Ab-Apt) and signal probe (denoted as F@UIO-66-NH2-p-LPS-Apt). | The limit of detection of A. baumannii in blood samples is 10 cfu/mL with a linear range of 10(1)–10(5) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate and 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1469 | 32095939 | 2020 | A fluorometric assay for rapid enrichment and determination of bacteria by using zirconium-metal organic frameworks as both capture surface and signal amplification tag | LPS-Apt | CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT | 86 | N/A | ssDNA | Acinetobacter Baumannii | Lipopolysaccharide (LPS) | A fluorometric assay was developed to determine A. baumannii in blood samples by utilizing Zr-MOFs as capture probe (denoted as Zr-mMOF-p-Ab-Apt) and signal probe (denoted as F@UIO-66-NH2-p-LPS-Apt). | The limit of detection of A. baumannii in blood samples is 10 cfu/mL with a linear range of 10(1)–10(5) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate and 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1470 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx1.1) | ATCCAGAGTGACGCAGCA-GTAGTTTGTTGGTTATTACGGCGGGTTGCGATGGGTGCGAATCGG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx1 (Stx1.1) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | LOD of 44.5 pg/mL for stx1 with minimal cross-reactivity and a dynamic response range from 50 pg/mL to 100 ng/mL. | 7 | Bio-Layer Interferometry (BLI) | 8.27 nM (of peptide) and 47.2 pM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1471 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx1.3) | ATCCAGAGTGACGCAGCA-GGATAGGACGTCAAATTAGGGCCCGGTACAACGAAAGCCCACAAC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx1 (Stx1.2) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 31.0 nM (of peptide) and 30.3 μΜ (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1472 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.1) | ATCCAGAGTGACGCAGCA-GGGGGCAGGTTCATGGCTTGGGTGCGGTGGGCATGATTCGTGGTG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.1) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 45.2 nM (of peptide) and 83.8 nM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1473 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.2) | ATCCAGAGTGACGCAGCA-TGTATCTCTTACTTAAGCCTTTGGTTCGGTAACAGCCTGGCATGC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.2) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 110 nM (of peptide) and 25.2 μM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1474 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.3) | ATCCAGAGTGACGCAGCA-GGAAAGGACGTCAAATTAGGGGCCGGGACAACGAAAGCCCACAAC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.3) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | LOD of 41.3 pg/mL for stx2 with minimal cross-reactivity and a dynamic response range from 50 pg/mL to 100 ng/mL. | 7 | Bio-Layer Interferometry (BLI) | 4.6 nM (of peptide) and 28.6 pM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1475 | 32774812 | 2020 | Point-of-care detection of Escherichia coli O157:H7 in water using AuNPs-based aptasensor | Apt 2 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (EHEC) (NTCC 12900) | Whole cell | Developed an aptamer-based AuNPs bioassay to detect EHEC in contaminated water. | Exhibited a good linear response over a wide concentration range of 876 to 107 CFU/mL and a low detection limit (LOD) of 263 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1476 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap1 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 18.10 ± 6.2 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1477 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap2 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 13.38 ± 3.8 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1478 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap3 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 11.46 ± 4.1 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1479 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap4 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 14.18 ± 4.3 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1480 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap5 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 21.78 ± 9.2 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1481 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap6 | TAGGGAAGAGAAGGACATATGAT-GCGCTGTGCGGATGTCATGATGTGCCTCTTCCCTGTGTCCGC-TTGACTAGTACATGACCACTTGA | 88 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | The detection limit of this aptasensor was as low as 10(5) CFU/ml within 10 minutes and a linear range of 10(5)-10(8) CFU/ml. | 10 | Flow Cytometry | 9.82 ± 3.6 nM | Biosensor | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1482 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap7 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 12.85 ± 4.1 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1483 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap8 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 32.90 ± 17.4 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1484 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap9 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 12.18 ± 4.3 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1485 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap10 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 32.85 ± 12.2 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1486 | 32151909 | 2020 | Surface-enhanced Raman spectroscopic-based aptasensor for Shigella sonnei using a dual-functional metal complex-ligated gold nanoparticles dimer | S. Sonnei aptamer | TGAGCCCAAGCCCTGGTATGTTCTTCCCTTTTATTAGTCCTGTATTCCTCTACTGTTGCCGGCAGGTCTACTTTGGGATC | 80 | N/A | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Developed a SERS aptasensor using a composite material integrated with the Raman active 4-MBA ligand of the Eu-complex and citrate-stabilised Au nanoparticles (cit-Au NPs) for the detection of S. sonnei. | Showed a good linear relationship in the range of 10–10(6) cfu/mL with a limit of detection (LOD) as low as 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1487 | 32347530 | 2020 | A sensitive and rapid bacterial antibiotic susceptibility test method by surface enhanced Raman spectroscopy | E. coli O157:H7 aptamer | GCAATGGTACGGTACTTCCCGCAGTTTGGGAAGGGTGATCGCACTATCAGAGGATTCCGTTCGGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC: 21530) | Whole cell | Developed a rapid antibiotic susceptibility test (AST) method and determined the MIC value by the Bacteria-aptamer@AgNPs-SERS method. | When treated with 2(−3) μg/mL tigecycline for 1 h, the Raman peak intensity of E. coli O157: H7 was 882 a.u., and when the concentration of antibiotics was sub-MIC (2(−4) and 2(−5) μg/mL), the peak value of 735 cm−1 increased, and the Raman intensity was 3382 a.u. and 4213 a.u. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1488 | 32347530 | 2020 | A sensitive and rapid bacterial antibiotic susceptibility test method by surface enhanced Raman spectroscopy | S. aureus aptamer | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 21600) | Whole cell | Developed a rapid antibiotic susceptibility test (AST) method and determined the MIC value by the Bacteria-aptamer@AgNPs-SERS method. | When treated with 2(−1) μg/mL vancomycin for 1 h, the Raman peak intensity of S. aureus was 556 a.u., and when the concentration of antibiotics was sub-MIC (2(−2) and 2(−3) μg/mL), the peak value of 735 cm−1 increased, and the Raman intensity was 2177 a.u. and 2903 a.u. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1489 | https://doi.org/10.1016/j.foodcont.2019.106761 | 2020 | Designing an aptamer based magnetic and upconversion nanoparticles conjugated fluorescence sensor for screening Escherichia coli in food | E.coli aptamer | ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 8739) | Whole cell | A novel upconversion fluorescence sensor using magnetic nanoparticles (MNPs) and cDNA-upconversion nanoparticles (UCNPs) for E.coli was developed. | Achieved a lower limit of detection (10 cfu/mL) in the linear range of 58–58 × 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1490 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M1 | AGCAGCACAGAGGTCAGATGATATAACCTTAATAAATAAAATATAAATTATTTAATCTTACCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 37.93 ± 7.88 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1491 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M5 | AGCAGCACAGAGGTCAGATGCTTGGTTCCACCGTACTGACTGTAGTAAAATCTGATCACTCCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 74.96 ± 21.34 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1492 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M7 | AGCAGCACAGAGGTCAGATGTAGTCGGTCTTCTTGTTTGAAACTGCTAATTTTGAAAAAACCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 73.02 ± 18.76 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1493 | 32800140 | 2020 | Developing a dual-RCA microfluidic platform for sensitive E. coli O157:H7 whole-cell detections | Aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Developed a dual-RCA microfluidic platform for sensitive detection of E. coli O157:H7 cells. | Achieved a linear range of 10(2) - 10(5) cells/mL with the limit of detection of 80 cells/mL in both orange juice and milk, thereby increasing overall detection signal intensities by approximately 250 times. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1494 | 32994896 | 2020 | Aptamer-nanobody based ELASA for detection of Vibrio cholerae O1 | V.ch27 | GCCTGTTGTGAGCCTCCTAAC-GGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCAC-CATGCTTATTCTTGTCTCC | 81 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Vibrio Cholerae O1 [Inaba (ATCC 39315) and Ogawa] | Whole cell | Identify aptamers and develop aptamer-nanobody-based ELISA for V. cholerae O1 detection. | The binding efficiency for V.ch27 was 53.3%. | 12 | Flow Cytometry | 20.186 ± 3.655 pM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1495 | 32994896 | 2020 | Aptamer-nanobody based ELASA for detection of Vibrio cholerae O2 | V.ch47 | GCCTGTTGTGAGCCTCCTAAC-CGTATTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTC-CATGCTTATTCTTGTCTCC | 79 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Vibrio Cholerae O1 [Inaba (ATCC 39315) and Ogawa] | Whole cell | Identify aptamers and develop aptamer-nanobody-based ELISA for V. cholerae O1 detection. | Identify 10(4) CFU/ml with 25 pM of biotinylated aptamer and only 20 μg/ml of VHH without any cross-reactivity. | 12 | Flow Cytometry | 15.404 ± 4.776 pM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1496 | https://doi.org/10.1016/j.sbsr.2019.100313 | 2020 | Aptamer-NanoZyme mediated sensing platform for the rapid detection of Escherichia coli in fruit juice | Aptamer P12–31(EC 12–31 TRUNC) | CCCTCCGGGGGGGTCATCGGGATACCTGGTAAGGATA | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | An aptamer and NanoZyme-based colorimetric and electrochemical assay was developed for EC detection in fruit juice. | Displayed superior linearity in the range of 10–10(9) CFUs/mL and a low-end detection limit of ~10 CFU within 5 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1497 | https://doi.org/10.1016/j.foodcont.2020.107281 | 2020 | A novel AuNPs colorimetric sensor for sensitively detecting viable Salmonella typhimurium based on dual aptamers | Apt1 | GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor based on AuNPs for visual detection of viable S. typhimurium. | Showed a linear range from 3.3 × 10(1) to 3.3 × 10(6) CFU/mL and the detection limit of 33 CFU/mL in pure culture and 95 CFU/mL in spiked milk. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1498 | https://doi.org/10.1016/j.foodcont.2020.107281 | 2020 | A novel AuNPs colorimetric sensor for sensitively detecting viable Salmonella typhimurium based on dual aptamers | Apt2 | CTCCTCTGACTGTAACCACGGAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGCCGCATAGGTAGTCCAGAAGCC | 80 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor based on AuNPs for visual detection of viable S. typhimurium. | Showed a linear range from 3.3 × 10(1) to 3.3 × 10(6) CFU/mL and the detection limit of 33 CFU/mL in pure culture and 95 CFU/mL in spiked milk. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1499 | 32200887 | 2020 | DNA aptamer-based non-faradaic impedance biosensor for detecting E. coli | OMP Ag1 aptamer | ATCCGTCACACCTGCTCT-ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA-TGGTGTTGGCTCCCGTAT | 73 | N/A | ssDNA | Escherichia Coli (E. Coli) BL21 strain | Outer membrane protein Ag1 (E. coli OMP Ag1) | Developed an impedance-based biosensor using aptamer-functionalized Interdigitated Electrode (IDE) arrays to detect E. coli. | Detection limit of 9 cfu/mL and linear concentration range of 25–1000 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1500 | 32000058 | 2020 | A SERS aptasensor for simultaneous multiple pathogens detection using gold decorated PDMS substrate | Apt 1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a SERS aptasensor using Apt-Au-PDMS film for simultaneous multiple-pathogen detection. | Can selectively detect 18 cfu/mL cells. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1501 | 32000058 | 2020 | A SERS aptasensor for simultaneous multiple pathogens detection using gold decorated PDMS substrate | Apt 2 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a SERS aptasensor using Apt-Au-PDMS film for simultaneous multiple-pathogen detection. | Can selectively detect 27 cfu/mL cells. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1502 | 32600757 | 2020 | A novel fluorometric aptasensor based on carbon nanocomposite for sensitive detection of Escherichia coli O157:H7 in milk | Anti-E. coli O157:H7 aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 25922) | Lipopolysaccharide (LPS) | CIP@MWCNT-based fluorometric aptasensor for detection of E. coli O157:H7. | The detection limit was as low as 7.15 × 10(3) cfu/mL in pure culture and 3.15 × 10(2) cfu/mL in contaminated milk with a linear range of 10(3)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | The fluorescent values of the CIP@MWCNT-based aptasensor were above 91.2% of the initial value at 4°C and −20°C after 4 wk. | N/A | N/A | N/A |