AptBacterialDB

Year : 2017

Total records found: 274

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0823 280693772017Development of an aptamer-ampicillin conjugate for treating biofilmsAptamer 3GGGAGCTCAGAATAAACGCTCAA-GGCAGGACAACAGCGTGTAGTATCAGCTTACGGTG-TTCGACATGAGGCCCGGATC78N/AssDNASalmonella CholeraesuisFlagellaAptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation.Biofilms containing the conjugate had the lowest survival ratio (37.22 ± 1.12%) compared with control conjugates.14Fluorescence Spectroscopy41 ± 2 nMTherapeuticsWhole Cell-SELEX3'-Amidation (NH₂) and 5'-FITC LabeledN/AN/ABest CandidateN/AN/A
ABdb_0824 280693772017Development of an aptamer-ampicillin conjugate for treating biofilmsAptamer 1GGGAGCTCAGAATAAACGCTCAA-GGCCAGCAGCGAGTGTGGAGTATTGTGTTGTGGTG-TTCGACATGAGGCCCGGATC78N/AssDNASalmonella CholeraesuisFlagellaAptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation.N/A14Fluorescence Spectroscopy50 ± 2 nMTherapeuticsWhole Cell-SELEXN/AN/AN/AN/AN/AN/A
ABdb_0825 280693772017Development of an aptamer-ampicillin conjugate for treating biofilmsAptamer 2GGGAGCTCAGAATAAACGCTCAA-GGGCAGGTGTTATGTGTACTGCTACAGTGTGGTTG-TTCGACATGAGGCCCGGATC78N/AssDNASalmonella CholeraesuisFlagellaAptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation.N/A14Fluorescence Spectroscopy54 ± 2 nMTherapeuticsWhole Cell-SELEXN/AN/AN/AN/AN/AN/A
ABdb_0826 280693772017Development of an aptamer-ampicillin conjugate for treating biofilmsAptamer 4GGGAGCTCAGAATAAACGCTCAA-GGCACGGCATGTGTGGTATGTGGTGCCTGTACTCG-TTCGACATGAGGCCCGGATC78N/AssDNASalmonella CholeraesuisFlagellaAptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation.N/A14Fluorescence Spectroscopy53 ± 5 nMTherapeuticsWhole Cell-SELEXN/AN/AN/AN/AN/AN/A
ABdb_0827 286467192017DNA aptamer-based colorimetric detection platform for Salmonella EnteritidisCrn-1AAGGGCTGGCTGGGATGGA-CCCTCCCGAAACGAGCTGTCTCTTAACGGAAGCTAATCTGCC-TCACTCCACGGACCCCACT805'-AAGGGCTGGCTGGGATGGA-N42-TCACTCCACGGACCCCACT-3'ssDNASalmonella Enteritidis (S. Enteritidis)Whole cellIdentify aptamers that bind to and develop a sandwich aptamer-based colorimetric bioassay to detect S. Enteritidis at 4°C.Display a LOD of 10(3) CFU/mL for S. Enteritidis.12Isothermal Titration Calorimetry (ITC)0.971 ± 0.013 µMBiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/ABest CandidateN/AN/A
ABdb_0828 286467192017DNA aptamer-based colorimetric detection platform for Salmonella EnteritidisCrn-2AAGGGCTGGCTGGGATGGA-TGTAAGAAGGGAGGAAAGGACCTAAGACCTGCTATATTGCGA-TCACTCCACGGACCCCACT805'-AAGGGCTGGCTGGGATGGA-N42-TCACTCCACGGACCCCACT-3'ssDNASalmonella Enteritidis (S. Enteritidis)Whole cellIdentify aptamers that bind to and develop a sandwich aptamer-based colorimetric bioassay to detect S. Enteritidis at 4°C.Display a LOD of 10(3) CFU/mL for S. Enteritidis.12Isothermal Titration Calorimetry (ITC)0.309 ± 0.071 µMBiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/ABest CandidateN/AN/A
ABdb_0829 286467192017DNA aptamer-based colorimetric detection platform for Salmonella EnteritidisCrn-3AAGGGCTGGCTGGGATGGA-GGATGGCATTACCTATGCGGTAGATTGCCGACGACCACGAC-TCACTCCACGGACCCCACT795'-AAGGGCTGGCTGGGATGGA-N42-TCACTCCACGGACCCCACT-3'ssDNASalmonella Enteritidis (S. Enteritidis)Whole cellIdentify aptamers that bind to and develop a sandwich aptamer-based colorimetric bioassay to detect S. Enteritidis at 4°C.N/A12Isothermal Titration Calorimetry (ITC)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0830 295945922017Selection of DNA aptamers against Mycobacterium tuberculosis Ag85A, and its application in a graphene oxide-based fluorometric assayApt22GCTGTGTGACTCCTGCAA-GCGGGAAGAGGGTAAGGGGAGGGAGGGTAACGCGGAGAAGGCAA-GCAGCTGTATCTTGTCTCC815'-GCTGTGTGACTCCTGCAA-N43-GCAGCTGTATCTTGTCTCC-3'ssDNAMycobacterium Tuberculosis (M.Tb.)Antigen 85 (Ag85A) (FbpA)Identify aptamers that bind to and develop a graphene oxide-based fluorometric assay to detect FbpA.Display LOD in PBS and serum of 1.5 nM and 2.1 nM, respectively, with an analytical linear range from 5 to 200 nM of FbpA.12Flow Cytometry62.95 nMBiosensorMagnetic Bead (MB)-based Protein SELEXATTO647N-labeledN/AN/ABest CandidateN/AN/A
ABdb_0831 295945922017Selection of DNA aptamers against Mycobacterium tuberculosis Ag85A, and its application in a graphene oxide-based fluorometric assayApt8GCTGTGTGACTCCTGCAA-TCAGGAAAGAACTTAGGGGTGGGAGGAGGGTATAAATACGGAAT-GCAGCTGTATCTTGTCTCC815'-GCTGTGTGACTCCTGCAA-N43-GCAGCTGTATCTTGTCTCC-3'ssDNAMycobacterium Tuberculosis (M.Tb.)Antigen 85 (Ag85A) (FbpA)Identify aptamers that bind to and develop a graphene oxide-based fluorometric assay to detect FbpA.N/A12Flow Cytometry202 nMBiosensorMagnetic Bead (MB)-based Protein SELEXATTO647N-labeledN/AN/AN/AN/AN/A
ABdb_0832 282066802017A single-stranded DNA aptamer against mannose-capped lipoarabinomannan enhances anti-tuberculosis activity of macrophages through downregulation of lipid-sensing nuclear receptor peroxisome proliferator-activated receptor γ expressionZXL1GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GGCGCCATAGCGACGGGGCCATTCCAAGAA-GGGTCAATGCGTCATA88N/AssDNAMycobacterium Tuberculosis (H37Rv) (ATCC 93009)Mannose-capped lipoarabinomannan (ManLAM) epitopeDownregulate PPARγ expression by blocking the binding of ManLAM to MR on macrophages, and ZXL1 enhances IL-1β and IL-12 mRNA expression and cytokine production in ManLAM-treated macrophages but decreases IL-10 production.The percentage of macrophages that took up iH37Rv decreased from 15.9% to 7.2%, thereby inhibiting ManLAM-induced immunosuppression of DCs.N/AN/AN/ATherapeutics/ImmunmodulatoryN/ABiotinylatedN/AN/AN/AN/AN/A
ABdb_0833 287780622017DNA aptamer functionalized gold nanostructures for molecular recognition and photothermal inactivation of methicillin-Resistant Staphylococcus aureusAptamerATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA755'-ATCCAGACGTGACGCAGC-N38-TGGACACGGTGGCTTAGTA-3'ssDNAMethicillin-resistant Staphylococcus aureus (MRSA) standard strain 43300Whole cellAptamer-functionalized gold nanorods (Apt@Au NRs) for inactivation of MRSA with targeted photothermal therapy (PTT).Over 95% inactivation of MRSA cells within 2 min.N/AN/AN/ATherapeuticsN/A3'-ThiolatedN/AN/AN/AN/AN/A
ABdb_0834 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaJN08ATGAGAGCGTCGGTGTGGTAACTTAATCCTCTAGTTTTAATTCTAGATACGGCGCATGCACTCTATGTAGGAGGGTGCGGAAGTA855'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry54.9 ± 7.8 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0835 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaJN27ATGAGAGCGTCGGTGTGGTAACTAGTCTGATTTCTATTTCCTTTAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA865'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry28.5 ± 4.9 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0836 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaJN27.SHTAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA435'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry26.9 ± 5.6 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0837 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaJN08.SHATGCACTCTATGTAGGAGGGTGCGGA265'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry52.9 ± 10.4 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0838 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaJN17.SHATCCTCCTATCTATCGGTAGTTGTAGGAGGGTGCGG365'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry29 ± 7.3 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0839 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaJN21.SHAGAGCGTCGGTGTGGTAACTGTTCAGGAGGATGACATTGTCGCCT455'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry18.1 ± 3.4 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0840 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaSt17Lp21ATCCTCCTAGGTAACTGTTCAGGATGTAGGAGGGT355'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry16.9 ± 3.9 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0841 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaSt21Lp17AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT385'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry13.5 ± 2 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0842 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaSt08Lp17ATGCACTCTTCTATCGGTAGTTGAGGGTGCGG325'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry12.5 ± 2.4 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0843 288185572017DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX methodAM-6CGTGATGATGTTGAGTTG-GGGTGATGGGTGCATGTGATGAAAGGGGTTCGTGCTATGCTGTTTTGTCTAATAATACTAGTCCTTGCCAAGGTTTATTC-CAGTAATGCCAACCAATCT1175'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3'ssDNAEscherichia Coli (E. Coli) O157:H7Whole cellIdentify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains.66.26% fluorescent cell intensity for E. coli O157 with less cross-reactivity.10Flow Cytometry107.6 ± 67.8 pMDetectionWhole Cell-SELEXFITC LabeledN/AN/ABest CandidateN/AN/A
ABdb_0844 288185572017DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX methodAM-5CGTGATGATGTTGAGTTG-GAGTTGCGTTGCTGAATGCATGGGCTGTACTAGGTTGGTGCTACTCTGTAATGTCTACTATTACTATTCCATCGCAACGTATACTG-CAGTAATGCCAACCAATCT1235'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3'ssDNAEscherichia Coli (E. Coli) O157:H7Whole cellIdentify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains.57.41% fluorescent cell intensity for E. coli O157 with less cross-reactivity.10Flow Cytometry120.4 ± 32.2 pMDetectionWhole Cell-SELEXFITC LabeledN/AN/AN/AN/AN/A
ABdb_0845 288185572017DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX methodAM-1CGTGATGATGTTGAGTTG-GCCGAGATTGAAGCTGGTGACCATTGGCCTTACTGGGATGCTCTTGTGATTACTACTACTAATCGTTGTGAACGTAAATGC-CAGTAATGCCAACCAATCT1185'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3'ssDNAEscherichia Coli (E. Coli) O157:H7Whole cellIdentify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains.N/A10Flow CytometryN/ADetectionWhole Cell-SELEXFITC LabeledN/AN/AN/AN/AN/A
ABdb_0846 288185572017DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX methodAM-2CGTGATGATGTTGAGTTG-GTGTTAATCCGTGTATGCCATGAGACCGGTAAGTCCTATTTTCGCTCCTGGAATGGTACAAGCTCATGTCAAGATATACTC-CAGTAATGCCAACCAATCT1185'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3'ssDNAEscherichia Coli (E. Coli) O157:H7Whole cellIdentify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains.N/A10Flow CytometryN/ADetectionWhole Cell-SELEXFITC LabeledN/AN/AN/AN/AN/A
ABdb_0847 288185572017DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX methodAM-3CGTGATGATGTTGAGTTG-GGGCAGATCCGTGCACATGATCTTAGCCGTACGTGTTCTGCGGTATAGTCTATTCATACTACCACTTCGCAATGTATATCG-CAGTAATGCCAACCAATCT1185'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3'ssDNAEscherichia Coli (E. Coli) O157:H7Whole cellIdentify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains.N/A10Flow CytometryN/ADetectionWhole Cell-SELEXFITC LabeledN/AN/AN/AN/AN/A
ABdb_0848 288185572017DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX methodAM-4CGTGATGATGTTGAGTTG-GTCGAGTACGGATCACTTGGAGATTGGCCATCGAGCTATTCTGTAATGTGTAATCCTACTACACCTTCGCATCGTTAATGC-CAGTAATGCCAACCAATCT1185'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3'ssDNAEscherichia Coli (E. Coli) O157:H7Whole cellIdentify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains.N/A10Flow CytometryN/ADetectionWhole Cell-SELEXFITC LabeledN/AN/AN/AN/AN/A
ABdb_0849 289414532017Development of a DNA Aptamer for Screening Neisseria meningitidis Serogroup B by Cell SELEXK3GCCTGTTGTGAGCCTCCTAACGCCAGGCGTTTTGGCCGTAGGCGTGGGAGACAAGAATAAGCA635'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3'ssDNANeisseria Meningitidis Serogroup B (ATCC 13090)Whole cellIdentity aptamers bind to and detect N. meningitidis in patients’ CSF samples.Detected 10(2) CFU of CSF isolated N. meningitidis.6Flow Cytometry28.3 ± 8.9 pMDetectionWhole Cell-SELEX5'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_0850 289414532017Development of a DNA Aptamer for Screening Neisseria meningitidis Serogroup B by Cell SELEXK4N/AN/A5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3'ssDNANeisseria Meningitidis Serogroup B (ATCC 13090)Whole cellIdentity aptamers bind to and detect N. meningitidis in patients’ CSF samples.N/A6Flow Cytometry39.1 ± 8.6 pMDetectionWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0851 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-5AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.Display a LOD of 10(4) with a linear range from 10(4) to 10(7) cfu/mL.12Flow Cytometry10.69 ± 0.89 nMBiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_0852 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-2AGCAGCACAGAGGTCAGATG-GCCTGGCCAGGTGCCCCGATATAGCGACGCCTTGCCCGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0853 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-4AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCCCGTGAGCGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0854 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-12AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0855 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-1AGCAGCACAGAGGTCAGATG-CGCCCTACACCACTCTCGGAGCGCTGTACGGCATCCCTGG-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0856 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-15AGCAGCACAGAGGTCAGATG-GCCCGCACCACACACAGATGTCCATGTGTGCGCTGCCGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0857 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-11AGCAGCACAGAGGTCAGATG-GCCTGGCCAGGTGCCCCGATATAGCGACGCCTTGCCCGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0858 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-23AGCAGCACAGAGGTCAGATG-GCCTGGCCAGGTGCCCCGATATAGCGACGCCTTGCCCGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0859 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-14AGCAGCACAGAGGTCAGATG-GCCTGGCCAGGTGCGCCGATATAGCCTGCCCTTGCCCGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0860 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-18AGCAGCACAGAGGTCAGATG-GCCTGGCCACGTGCGCGGATATAGCCTGCCCTTGGCCGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0861 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-9AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCCCGTGAGCGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0862 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-25AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCCCGTGAGCGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0863 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-28AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCCCGTGAGCGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0864 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-7AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCGGGTGAGCGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0865 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-6AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0866 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-17AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0867 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-21AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0868 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-26AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0869 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-27AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0870 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-30AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0871 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-29AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCGGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0872 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-3AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCGGGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0873 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-13AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0874 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-16AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0875 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-22AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0876 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-24AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0877 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-19AGCAGCACAGAGGTCAGATG-GTCACACGGCCCGTCTGCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0878 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-20AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTCTGGCACGCCGGCTGTGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0879 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-8AGCAGCACAGAGGTCAGATG-GCCCGCGCCCCTTCTGCCGTTGGTCGGAACCCCTGTGCGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0880 284413402017Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidumCCFM641-10AGCAGCACAGAGGTCAGATG-GCCCGCGCGGGTTCTGCCGTTGGTGGGAACCCCTGTGCGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Bifidum (ATCC 29521)Membrane proteinIdentify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0881 https://doi.org/10.1039/C6RA27672E2017Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breveBB2pAGCAGCACAGAGGTCAGATG-CCGGGCAGCGGTCAATGCCGCACCTTCCATATGATCGGGG-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Breve (ATCC 15700)Whole cellIdentify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples.The per cent gated fluorescence intensity above the background was 8.9% for BB2p.12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0882 https://doi.org/10.1039/C6RA27672E2017Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breveBB10pAGCAGCACAGAGGTCAGATG-GGCCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Breve (ATCC 15700)Whole cellIdentify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples.The per cent gated fluorescence intensity above the background was 11.2% for BB10p.12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0883 https://doi.org/10.1039/C6RA27672E2017Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breveBB16pAGCAGCACAGAGGTCAGATG-CTCCCAGGCCGTTGGGGCGTTGCCTGCGTGCACCCGGGGC-CCTATGCGTGCTACCGTGAA805'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Breve (ATCC 15700)Whole cellIdentify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples.The per cent gated fluorescence intensity above the background was 7.0% for BB16p.12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0884 https://doi.org/10.1039/C6RA27672E2017Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breveBB2CCGGGCAGCGGTCAATGCCGCACCTTCCATATGATCGGGG405'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Breve (ATCC 15700)Whole cellIdentify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples.BB2 showed a lower binding affinity than the aptamer BB2p.12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0885 https://doi.org/10.1039/C6RA27672E2017Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breveBB10GGCCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC405'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Breve (ATCC 15700)Whole cellIdentify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples.Demonstrated higher binding affinity than the original full-length aptamer.12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0886 https://doi.org/10.1039/C6RA27672E2017Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breveBB16CTCCCAGGCCGTTGGGGCGTTGCCTGCGTGCACCCGGGGC405'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Breve (ATCC 15700)Whole cellIdentify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples.Demonstrated higher binding affinity than the original full-length aptamer.12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0887 https://doi.org/10.1039/C6RA27672E2017Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breveBB10-6fGGCCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTT345'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Breve (ATCC 15700)Whole cellIdentify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0888 https://doi.org/10.1039/C6RA27672E2017Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breveBB10-10fGGCCCCCTGCCTGCCAAAAAGGTGTTGCCA305'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Breve (ATCC 15700)Whole cellIdentify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0889 https://doi.org/10.1039/C6RA27672E2017Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breveBB10-14fGGCCCCCTGCCTGCCAAAAAGGTGTT265'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Breve (ATCC 15700)Whole cellIdentify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0890 https://doi.org/10.1039/C6RA27672E2017Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breveBB10-2rCCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC385'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Breve (ATCC 15700)Whole cellIdentify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0891 https://doi.org/10.1039/C6RA27672E2017Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breveBB10-9rCCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC315'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Breve (ATCC 15700)Whole cellIdentify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0892 https://doi.org/10.1039/C6RA27672E2017Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breveBB10-13rCCAAAAAGGTGTTGCCAGGTTGGCGGC275'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Breve (ATCC 15700)Whole cellIdentify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0893 https://doi.org/10.1039/C6RA27672E2017Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breveBB16-11fCTCCCAGGCCGTTGGGGCGTTGCCTGCGT295'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Breve (ATCC 15700)Whole cellIdentify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples.LOD of the assay was 1000 cfu/mL with a linear range from 10(3) to 10(7) cfu/mL.12Flow Cytometry18.66 ± 1.41 nMBiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_0894 https://doi.org/10.1039/C6RA27672E2017Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breveBB16-13fCTCCCAGGCCGTTGGGGCGTTGCCTGC275'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Breve (ATCC 15700)Whole cellIdentify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0895 https://doi.org/10.1039/C6RA27672E2017Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breveBB16-15fCTCCCAGGCCGTTGGGGCGTTGCCT255'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Breve (ATCC 15700)Whole cellIdentify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0896 https://doi.org/10.1039/C6RA27672E2017Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breveBB16-8rCCGTTGGGGCGTTGCCTGCGTGCACCCGGGGC325'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'ssDNABifidobacterium Breve (ATCC 15700)Whole cellIdentify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples.N/A12Flow CytometryN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0897 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-3ATACCAGCTTATTCAATTCCA-TGGTCCCTCGTGTTTATTATGTTGTCTGAACTGGCTG-AGATTGCACTTACTATCT765'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.Sandwich complex pair of SS-3 and SS-4 shows a linear dynamic range of 10(3)-10(6) cells/mL, and a limit of detection of 10(3) cells per mL for S. sonnei.8Surface Plasmon Resonance (SPR)39.32 ± 5.02 nMBiosensorWhole Cell-SELEX5'-Cyanine5 (Cy5) Labeled or 5′-BiotinylatedN/AN/ABest CandidateN/AN/A
ABdb_0898 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-4ATACCAGCTTATTCAATTCCA-CACATACCAAAAACACAGCACACTTCATCAATTTCACG-AGATTGCACTTACTATCT775'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.Sandwich complex pair of SS-3 and SS-4 shows a linear dynamic range of 10(3)-10(6) cells/mL, and a limit of detection of 10(3) cells per mL for S. sonnei.8Surface Plasmon Resonance (SPR)15.89 ± 1.77 nMBiosensorWhole Cell-SELEX5'-Amidation (NH₂) and 5'-BiotinylatedN/AN/ABest CandidateN/AN/A
ABdb_0899 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-1ATACCAGCTTATTCAATTCCA-GGGCATGTGGACCTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0900 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-2ATACCAGCTTATTCAATTCCA-CCCCATGTCTGTTTCTTTTAACAGGTAATCCGCCTTATGC-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0901 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-5ATACCAGCTTATTCAATTCCA-CAGGACAAAAATTCGGGAAGGCGGCCTTCCACTCTTTCTG-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0902 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-6ATACCAGCTTATTCAATTCCA-ATACAGTGAAGGCCCAGGAGGCAAATTCTAGGACGAAAGC-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0903 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-7ATACCAGCTTATTCAATTCCA-CACCAAGTCGCCTCCTCTGCCCCCATGTAAATCGTTACAT-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0904 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-8ATACCAGCTTATTCAATTCCA-GAACAATTTCACGCACACCGCGTAGATACCACCTCGTGCA-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0905 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-9ATACCAGCTTATTCAATTCCA-CGACGAACTACACCACAGGCCCTTAACACATCTACTTGTA-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0906 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-10ATACCAGCTTATTCAATTCCA-CATGCTAACTGCCATCACCACTATTTATGATTCCATCCAT-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0907 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-11ATACCAGCTTATTCAATTCCA-CGCAACACAGAAACACCCGTACACAAACAGTTTCAGCCCG-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0908 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-12ATACCAGCTTATTCAATTCCA-TGCGTAGTTCTCTTAACAACCATTCAGCGTATTTTCGTGG-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0909 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-13ATACCAGCTTATTCAATTCCA-CAGGCACGAGTTCATCACACACCATACACAGTTCGTTACT-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0910 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-14ATACCAGCTTATTCAATTCCA-CCACACCACACACTACACGCATAAAACCACGAAACTACAC-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0911 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-15ATACCAGCTTATTCAATTCCA-GGGTATGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0912 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-16ATACCAGCTTATTCAATTCCA-CATACAGTGGCCAGATTTACCAACACACCTTTCCATACGC-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0913 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-17ATACCAGCTTATTCAATTCCA-CCACTCACATATTAACAACACCACATGAATATATTTCG-AGATTGCACTTACTATCT775'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0914 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-18ATACCAGCTTATTCAATTCCA-ACAGGGCATGTCTTCATCAACGCTTACCACACACCGCTCG-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0915 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-19ATACCAGCTTATTCAATTCCA-CACTCATGCGCACCGCGTCGCACTTAATCAGTGTTGTGC-AGATTGCACTTACTATCT785'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0916 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-20ATACCAGCTTATTCAATTCCA-GGGCATGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0917 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-21ATACCAGCTTATTCAATTCCA-CAGACACACCAACGCACGGGCACACGCTACAAATGTAAGT-AGATTGCACTTACTATCT795'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.N/A8Surface Plasmon Resonance (SPR)N/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0918 281195142017High Efficiency Binding Aptamers for a Wide Range of Bacterial Sepsis AgentsAntibac1TCGCGCGAGTCGTCTG-GGGACAGGGAGTGCGCTGCTCCCC-CCGCATCGTCCTCCC55N/AssDNAEscherichia Coli (E. Coli) (ATCC 25922), Klebsiella Pneumoniae (ATCC 27853), Proteus Mirabilis (ATCC 00557), Pseudomonas Aeruginosa (ATCC 700603), Staphylococcus aureus (S. aureus) (ATCC 29213), Streptococcus Pneumoniae (ATCC 23855), and Enterococcus Faecium (ATCC 29212), and Proteus Vulgaris, Morganella Morganii, Citrobacter Freundii, and Acinetobacter BaumanniiPeptidoglycanDevelop generic probes as biological recognition elements in biosensors for sepsis diagnosis in the clinical setting.Antibac1 bound with higher efficiency to both gram-positive (S. aureus, S. penumoniae, L. monocytogenes) and gram-negative (A. baumannii, C. freudii, K. pneumoniae, P. aeruginosa, P. mirabilis).N/AReal-Time Quantitative Polymerase Chain Reaction (RT-qPCR)268.50 ± 54.34 nM (for A. baumannii); 51.74 ± 11.75 nM (for L. monocytogenes); 31.82 ± 4.38 nM (for E.coli); 170.10 ± 32.13 nM (for S.aureus) and 256.10 ± 47.89 nM (for K. pneumoniae)DiagnosticN/AN/AN/AN/AN/AN/AN/A
ABdb_0919 281195142017High Efficiency Binding Aptamers for a Wide Range of Bacterial Sepsis AgentsAntibac2TCGCGCGAGTCGTCTG-GGGGACTAGAGGACTTGTGCGGCC-CCGCATCGTCCTCCC55N/AssDNAEscherichia Coli (E. Coli) (ATCC 25922), Klebsiella Pneumoniae (ATCC 27853), Proteus Mirabilis (ATCC 00557), Pseudomonas Aeruginosa (ATCC 700603), Staphylococcus aureus (S. aureus) (ATCC 29213), Streptococcus Pneumoniae (ATCC 23855), and Enterococcus Faecium (ATCC 29212), and Proteus Vulgaris, Morganella Morganii, Citrobacter Freundii, and Acinetobacter BaumanniiPeptidoglycanDevelop generic probes as biological recognition elements in biosensors for sepsis diagnosis in the clinical setting.Antibac2 bound with higher efficiency to the gram-positive species S. aureus and E. faecium and to the gram-negative species (A. baumannii, C. freudii, K. pneumoniae, M. moraganii, P. aeruginosa, P. mirabilis, and E. coli).N/AReal-Time Quantitative Polymerase Chain Reaction (RT-qPCR)71.92 ± 9.74 nM (for A. baumannii); 54.19 ± 12.09 nM (for L. monocytogenes); 62.43 ± 11.97 nM (for E.coli); 194.90 ± 38.55 nM (for S.aureus) and 195.90 ± 42.91 nM (for K. pneumoniae)DiagnosticN/AN/AN/AN/AN/AN/AN/A
ABdb_0920 286891122017Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensorAptamer 1GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATC555'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'ssDNAMycobacterium Tuberculosis (H37Rv) (ATCC 27294)Whole cellIdentify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain.The detection time for M. tuberculosis was 70 min, and the detection limit was 100 cfu/mL.14Fluorescence Spectroscopy37 ± 4 nMBiosensorWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/ABest CandidateN/AN/A
ABdb_0921 286891122017Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensorAptamer 2GGGAGCTCAGAATAAACGCTCAA-GGCACACAGGACTATACAGTGTTGCAGTGTTGCTG-TTCGACATGAGGCCCGGATC555'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'ssDNAMycobacterium Tuberculosis (H37Rv) (ATCC 27294)Whole cellIdentify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain.N/A14Fluorescence Spectroscopy97 ± 4 nMBiosensorWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_0922 286891122017Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensorAptamer 3GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATC555'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'ssDNAMycobacterium Tuberculosis (H37Rv) (ATCC 27294)Whole cellIdentify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain.N/A14Fluorescence Spectroscopy101 ± 5 nMBiosensorWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_0923 286891122017Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensorAptamer 4GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATC555'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'ssDNAMycobacterium Tuberculosis (H37Rv) (ATCC 27294)Whole cellIdentify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain.N/A14Fluorescence Spectroscopy98 ± 7 nMBiosensorWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_0924 286891122017Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensorAptamer 5GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTACCCGATATGTGTCCGAGTGGTG-TTCGACATGAGGCCCGGATC555'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'ssDNAMycobacterium Tuberculosis (H37Rv) (ATCC 27294)Whole cellIdentify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain.N/A14Fluorescence Spectroscopy96 ± 8 nMBiosensorWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_0925 286891122017Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensorAptamer 6GGGAGCTCAGAATAAACGCTCAA-GGCACGATGTGGCTACATCGATCGCGGTACTGGTG-TTCGACATGAGGCCCGGATC555'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'ssDNAMycobacterium Tuberculosis (H37Rv) (ATCC 27294)Whole cellIdentify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain.N/A14Fluorescence Spectroscopy103 ± 6 nMBiosensorWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_0926 286891122017Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensorAptamer 7GGGAGCTCAGAATAAACGCTCAA-GGCAGGTGGTGTTGGTTGGTTGTGCGTGGAGTTGG-TTCGACATGAGGCCCGGATC785'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'ssDNAMycobacterium Tuberculosis (H37Rv) (ATCC 27294)Whole cellIdentify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain.N/A14Fluorescence Spectroscopy107 ± 9 nMBiosensorWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_0927 286891122017Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensorAptamer 8GGGAGCTCAGAATAAACGCTCAA-GGCAGCAGCAATGTAACACTGTGTGTATGTGTTGG-TTCGACATGAGGCCCGGATC785'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'ssDNAMycobacterium Tuberculosis (H37Rv) (ATCC 27294)Whole cellIdentify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain.N/A14Fluorescence Spectroscopy102 ± 8 nMBiosensorWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_0928 286891122017Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensorAptamer 9GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATC785'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'ssDNAMycobacterium Tuberculosis (H37Rv) (ATCC 27294)Whole cellIdentify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain.N/A14Fluorescence Spectroscopy108 ± 4 nMBiosensorWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_0929 286891122017Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensorAptamer10GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAGGTGGTG-TTCGACATGAGGCCCGGATC785'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'ssDNAMycobacterium Tuberculosis (H37Rv) (ATCC 27294)Whole cellIdentify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain.N/A14Fluorescence Spectroscopy110 ± 3 nMBiosensorWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_0930 286891122017Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensorAptamer11GGGAGCTCAGAATAAACGCTCAA-GGCACGATGTGGCTACATCGATCGCGGTACTGGTG-TTCGACATGAGGCCCGGATC785'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'ssDNAMycobacterium Tuberculosis (H37Rv) (ATCC 27294)Whole cellIdentify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain.N/A14Fluorescence Spectroscopy103 ± 4 nMBiosensorWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_0931 286891122017Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensorAptamer12GGGAGCTCAGAATAAACGCTCAA-GGGGAGGCAGTGTGTTGTGTCGTGTGTGTGCTTGG-TTCGACATGAGGCCCGGATC785'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'ssDNAMycobacterium Tuberculosis (H37Rv) (ATCC 27294)Whole cellIdentify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain.N/A14Fluorescence Spectroscopy110 ± 7 nMBiosensorWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_0932 276965542017Evaluation of Staphylococcus aureus DNA aptamer by enzyme-linked aptamer assay and isothermal titration calorimetrySA31TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA45N/AssDNAMethicillin-resistant Staphylococcus aureus (MRSA)Whole cellELAA and ITC to study impact of temperature and ion concentration in the binding of aptamer to its target on surface of bacteria.Both temperature and salt concentration directly influenced the 3D structure of the DNA molecule under specified experimental conditions, thereby altering the aptamer's affinity for its target.N/AN/AN/ADetectionN/A5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0933 284546522017Selection, characterization, and application of DNA aptamers for detection of Mycobacterium tuberculosis secreted protein MPT64Aptamer 17TCACTTCAAATGTGCGCTTC-GTCAACAGTCCAGTTGGGAGGTCGCTTATAGCTGCTTGTC-CGTCAAAACAGGGGGTAGAA805'-TCACTTCAAATGTGCGCTTC-N40-CGTCAAAACAGGGGGTAGAA-3'ssDNAMycobacterium Tuberculosis (H37Rv)MPT64 protein (Rv1980c)Identify DNA aptamers against MPT64 protein.The ELONA assay had a sensitivity and specificity of 91.3% and 90% on sputum samples.10Surface Plasmon Resonance (SPR)8.92 nMDetectionSELEXBiotinylatedN/AN/AN/AN/AN/A
ABdb_0934 278258862017Upconversion nanoparticles based FRET aptasensor for rapid and ultrasenstive bacteria detectionE.coli aptamerGCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAEscherichia Coli (E. Coli) (ATCC 8739)Whole cellUpconversion nanoparticles (UCNPs) based FRET aptasensor (UCNPs-cDNA from AuNPs-aptamers) for detecting E. coli in tap/pond water and milk.Display a detection range of 5–10(6) cfu/mL and a detection limit of 3 cfu/mL in 20 min.N/AN/AN/ABiosensorN/A3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0935 280099142017Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria8.1AGCGC(U^y)CGCGCGGCG(U^y)GC-ACAACAAA(U^y)G(U^y)GACCA(U^y)GCGA(U^y)(U^y)CCCCA(U^y)A(U^y)CCAGGCACA-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC775'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3'ssDNAEscherichia Coli (E. Coli) DH5αWhole cellIdentify modified aptamers that were isolated against Escherichia coli DH5α cells.N/A12Saturation Binding AssayN/ADetectionWhole Cell-SELEXPhenol-modified dUTP (dU^yTP)N/AN/AN/AN/AN/A
ABdb_0936 280099142017Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria8.2AGCGC(U^y)CGCGCGGCG(U^y)GC-GA(U^y)GCG(U^y)G(U^y)GG(U^y)G(U^y)GGAG(U^y)(U^y)G(U^y)G(U^y)GAG(U^y)GG(U^y)C(U^y)GCG(U^y)(U^y)G(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC775'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3'ssDNAEscherichia Coli (E. Coli) DH5αWhole cellIdentify modified aptamers that were isolated against Escherichia coli DH5α cells.N/A12Saturation Binding AssayN/ADetectionWhole Cell-SELEXPhenol-modified dUTP (dU^yTP)N/AN/AN/AN/AN/A
ABdb_0937 280099142017Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria8.5BGCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)(U^y)CA(U^y)GCCC(U^y)G(U^y)G(U^y)C(U^y)(U^y)GC(U^y)C(U^y)(U^y)G(U^y)GAG(U^y)(U^y)G(U^y)(U^y)G(U^y)G(U^y)CA-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC765'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3'ssDNAEscherichia Coli (E. Coli) DH5αWhole cellIdentify modified aptamers that were isolated against Escherichia coli DH5α cells.N/A12Saturation Binding AssayN/ADetectionWhole Cell-SELEXPhenol-modified dUTP (dU^yTP)N/AN/AN/AN/AN/A
ABdb_0938 280099142017Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria8.8AGCGC(U^y)CGCGCGGCG(U^y)GC-G(U^y)G(U^y)G(U^y)A(U^y)GCG(U^y)(U^y)CA(U^y)G(U^y)GG(U^y)GAGG(U^y)C(U^y)(U^y)GCG(U^y)C(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC765'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3'ssDNAEscherichia Coli (E. Coli) DH5αWhole cellIdentify modified aptamers that were isolated against Escherichia coli DH5α cells.N/A12Saturation Binding AssayN/ADetectionWhole Cell-SELEXPhenol-modified dUTP (dU^yTP)N/AN/AN/AN/AN/A
ABdb_0939 280099142017Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria8.10AGCGC(U^y)CGCGCGGCG(U^y)GC-GAG(U^y)G(U^y)G(U^y)G(U^y)GGG(U^y)CCGAG(U^y)GGG(U^y)GG(U^y)CAGGG(U^y)(U^y)(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC765'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3'ssDNAEscherichia Coli (E. Coli) DH5αWhole cellIdentify modified aptamers that were isolated against Escherichia coli DH5α cells.Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%.12Saturation Binding AssayN/ADetectionWhole Cell-SELEXPhenol-modified dUTP (dU^yTP)N/AN/AN/AN/AN/A
ABdb_0940 280099142017Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria8.14BGCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)C(U^y)G(U^y)G(U^y)GCGG(U^y)G(U^y)(U^y)A(U^y)GCGGG(U^y)(U^y)GGG(U^y)(U^y)G(U^y)(U^y)(U^y)G(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC765'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3'ssDNAEscherichia Coli (E. Coli) DH5αWhole cellIdentify modified aptamers that were isolated against Escherichia coli DH5α cells.Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%.12Saturation Binding AssayN/ADetectionWhole Cell-SELEXPhenol-modified dUTP (dU^yTP)N/AN/AN/AN/AN/A
ABdb_0941 280099142017Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria8.16BGCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)(U^y)(U^y)GCG(U^y)CCGGG(U^y)(U^y)(U^y)A(U^y)GCGGG(U^y)(U^y)G(U^y)C(U^y)CG(U^y)G(U^y)C(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC765'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3'ssDNAEscherichia Coli (E. Coli) DH5αWhole cellIdentify modified aptamers that were isolated against Escherichia coli DH5α cells.N/A12Saturation Binding AssayN/ADetectionWhole Cell-SELEXPhenol-modified dUTP (dU^yTP)N/AN/AN/AN/AN/A
ABdb_0942 280099142017Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria8.17BGCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)C(U^y)(U^y)G(U^y)(U^y)GGG(U^y)CGACGG(U^y)C(U^y)G(U^y)(U^y)CA(U^y)G(U^y)GGG(U^y)G(U^y)(U^y)G(U^y)CCC-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC775'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3'ssDNAEscherichia Coli (E. Coli) DH5αWhole cellIdentify modified aptamers that were isolated against Escherichia coli DH5α cells.N/A12Saturation Binding AssayN/ADetectionWhole Cell-SELEXPhenol-modified dUTP (dU^yTP)N/AN/AN/AN/AN/A
ABdb_0943 280099142017Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria8.18BGCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)(U^y)G(U^y)G(U^y)(U^y)CACG(U^y)CA(U^y)(U^y)(U^y)CGCAC(U^y)CC(U^y)C(U^y)CAGC(U^y)ACG(U^y)(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC775'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3'ssDNAEscherichia Coli (E. Coli) DH5αWhole cellIdentify modified aptamers that were isolated against Escherichia coli DH5α cells.Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%.12Saturation Binding AssayN/ADetectionWhole Cell-SELEXPhenol-modified dUTP (dU^yTP)N/AN/AN/AN/AN/A
ABdb_0944 280099142017Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria8.24AGCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)G(U^y)G(U^y)(U^y)(U^y)G(U^y)GG(U^y)ACGAGCG(U^y)G(U^y)G(U^y)GGA(U^y)GG(U^y)CCG(U^y)G(U^y)CA-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC765'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3'ssDNAEscherichia Coli (E. Coli) DH5αWhole cellIdentify modified aptamers that were isolated against Escherichia coli DH5α cells.N/A12Saturation Binding AssayN/ADetectionWhole Cell-SELEXPhenol-modified dUTP (dU^yTP)N/AN/AN/AN/AN/A
ABdb_0945 280099142017Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria8.28AGCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)CC(U^y)CGCG(U^y)(U^y)(U^y)GGA(U^y)(U^y)CA(U^y)G(U^y)(U^y)GG(U^y)(U^y)(U^y)G(U^y)CGG(U^y)G(U^y)A(U^y)(U^y)G(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC775'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3'ssDNAEscherichia Coli (E. Coli) DH5αWhole cellIdentify modified aptamers that were isolated against Escherichia coli DH5α cells.Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%.12Saturation Binding Assay27.4 ± 18.7 nMDetectionWhole Cell-SELEXPhenol-modified dUTP (dU^yTP) and Radiolabelled ([γ-32P]-labeled)N/AN/ABest CandidateN/AN/A
ABdb_0946 280099142017Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria8.30AGCGC(U^y)CGCGCGGCG(U^y)GC-ACAGAAAG(U^y)G(U^y)GGCCA(U^y)G(U^y)G(U^y)(U^y)G(U^y)G(U^y)CCC(U^y)GGCAGG(U^y)(U^y)AG(U^y)(U^y)(U^y)A-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC815'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3'ssDNAEscherichia Coli (E. Coli) DH5αWhole cellIdentify modified aptamers that were isolated against Escherichia coli DH5α cells.N/A12Saturation Binding AssayN/ADetectionWhole Cell-SELEXPhenol-modified dUTP (dU^yTP)N/AN/AN/AN/AN/A
ABdb_0947 285511172017Electrochemical determination of M. tuberculosis antigen based on Poly(3,4-ethylenedioxythiophene) and functionalized carbon nanotubes hybrid platformMPT64 aptamerGTACAAACGACGGCCAGT-CCTTGGGATGATTCAAGCAAAGCCTCACGCCTACGGCTAA-GTCATAGCTGTCTCTCCTG775'-GTACAAACGACGGCCAGT-N40-GTCATAGCTGTCTCTCCTG-3'ssDNAMycobacterium Tuberculosis (M.Tb.)MPT64 proteinDeveloped an electrochemical aptasensor based on MWCNT-doped PEDOT nano-composite for the detection of Mycobacterium tuberculosis.Exhibits a LOD of 0.5 fg/mL within 15 min for the detection of M. tb antigenic protein with recovery in between (88–95)%.N/AN/AN/ABiosensorSELEX5'-BiotinylatedN/AThe stability of the aptasensor is 27 days at 4°C, and the reusability is 7 times after repeated regeneration with 50 mM NaOH.N/AN/AN/A
ABdb_0948 284149752017Fullerene-doped polyaniline as new redox nanoprobe and catalyst in electrochemical aptasensor for ultrasensitive detection of Mycobacterium tuberculosis MPT64 antigen in human serumMBA ITGGGAGCTGATGTCGCATGGGTTTTGATCACATGA35N/AssDNAMycobacterium Tuberculosis (M.Tb.)MPT64 proteinElectrochemical aptasensor based on GNPs-C60-PAn labelled with signal aptamer for the determination of MTB antigen.A wide linear detection range of 0.02 to 1000 pg/mL was obtained, with a detection limit of 20 fg/mL for MPT64.N/AN/AN/ABiosensorN/A5'-Thiolated (HS-(CH2)6)N/AN/AN/AN/AN/A
ABdb_0949 284149752017Fullerene-doped polyaniline as new redox nanoprobe and catalyst in electrochemical aptasensor for ultrasensitive detection of Mycobacterium tuberculosis MPT64 antigen in human serumMBA IITTCGGGAATGATTATCAAATTTATGCCCTCTGAT34N/AssDNAMycobacterium Tuberculosis (M.Tb.)MPT64 proteinElectrochemical aptasensor based on GNPs-C60-PAn labelled with signal aptamer for the determination of MTB antigen.A wide linear detection range of 0.02 to 1000 pg/mL was obtained, with a detection limit of 20 fg/mL for MPT64.N/AN/AN/ABiosensorN/A5'-Thiolated (HS-(CH2)6)N/AN/AN/AN/AN/A
ABdb_0950 https://doi.org/10.1007/s00604-017-2142-22017A magnetic relaxation switch aptasensor for the rapid detection of Pseudomonas aeruginosa using superparamagnetic nanoparticlesAptamerCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas Aeruginosa (ATCC 27853)Whole cellDevelop a magnetic relaxation switch (MRSw) aptasensor (SPIO-aptamer) for the determination of Pseudomonas aeruginosa in real food and drinking water samples.Exhibit a linear range from 10(0) cfu/mL to 10(6) cfu/mL, and a detection limit of 50 cfu/mL was obtained within 40 mins.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0951 https://doi.org/10.1016/j.snb.2017.09.1212017Novel impedimetric aptasensor for label-free detection of Escherichia coli O157:H7E. coli specific aptamerATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT72N/AssDNAEscherichia Coli (E. Coli)Whole cellDeveloped a novel impedance-based aptasensor for the detection of E. coli O157:H7.Exhibited a broad range from 10(1) to 10(5) cfu/mL with the LOD about 2.9 × 10(2) cfu/mL with a detection time of 30 min.N/AN/AN/ABiosensorN/A5'-disulfide-modifiedN/AN/AN/AN/AN/A
ABdb_0952 https://doi.org/10.1016/j.foodcont.2017.07.0162017SERS aptasensor for Salmonella typhimurium detection based on spiny gold nanoparticlesS. typhimurium aptamerTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium)Whole cellDeveloped a novel SGNPs-based SERS aptasensor functionalized with p-MBA for the detection of S. typhimurium.Display linear range 10(1) cfu/mL to 10(5) cfu/mL, with a limit of detection (LOD) of 4 cfu/mL.N/AN/AN/ABiosensorN/A5'-Thiolated or BiotinylatedN/AN/AN/AN/AN/A
ABdb_0953 291608512017Development of An Impedimetric Aptasensor for the Detection of Staphylococcus aureusPA#2/8[S1-58]ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT58N/AssDNAStaphylococcus aureus (S. aureus) (DSM 20231)Staphylococcus aureus Protein A (SpA)Developed an impedimetric aptasensor for the detection of S. aureus.Showed a limit of detection of 10 CFU/mL within 10 minutes.N/AElectrochemical impedance spectroscopy (EIS)18.5 ± 1.8BiosensorN/A3'-ThiolatedN/AN/AN/AN/AN/A
ABdb_0954 290516202017Antimicrobial peptide-loaded gold nanoparticle-DNA aptamer conjugates as highly effective antibacterial therapeutics against Vibrio vulnificusApt(His)GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC40N/AssDNAVibrio Vulnificus (MO6-24/O)V. vulnificus-infected HeLa cellsThe AuNP-AptHis conjugate delivers the HPA3P(His) peptide into host cells, inducing bacterial cell death by disrupting membrane integrity.Compared with that of buffer- or AuNP-AptHis-incubated cells, the number of viable V. vulnificus cells in the AuNP-AptHis-HPA3PHis-treated cells decreased by 90% in 10 min. All infected mice injected with AuNP-AptHis-HPA3PHis survived until 120 h.N/AN/AN/ATargeted Delivery/TherapeuticsN/A3'-Thiolated (A10-Thiol)HPA3PHis and AuNP-Apt(His)-HPA3P(His) did not exhibit cytotoxicity against HeLa cells and mouse erythrocytes up to 10 µM.N/AN/AN/AN/A
ABdb_0955 290712022017An Electrochemical Aptasensor Using Coaxial Capillary with Magnetic Nanoparticle, Urease Catalysis and PCB Electrode for Rapid and Sensitive Detection of Escherichia coli O157:H7E. coli aptamerCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG42N/AssDNAEscherichia Coli (E. Coli) O157:H7 (ATCC 43888)Whole cellDevelop an electrochemical aptasensor for rapid and sensitive detection of E. coli O157:H7 that relies on aptamer and urease-modified GNPs.Able to detect E. coli as low as 10(1) CFU/mL in 3 h, and the mean recovery of E. coli in the spiked pasteurized milk was ~99%.N/AN/AN/ABiosensorN/A5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0956 288034752017Intuitive Label-Free SERS Detection of Bacteria Using Aptamer-Based in Situ Silver Nanoparticles SynthesisS.aureus-AptamerSTCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC62N/AssDNAStaphylococcus aureus (S. aureus) (CICC 21600)Whole cellDeveloped a SERS-based aptasensor using aptamer@AgNPs for the detection of bacteria.Exhibited a linear concentration, ranging from 10(1) to 10(7) cfu/mL with the detection limit of 1.5 cfu/mL.N/AN/AN/ABiosensorN/AFAM LabeledN/AN/AN/AN/AN/A
ABdb_0957 288034752017Intuitive Label-Free SERS Detection of Bacteria Using Aptamer-Based in Situ Silver Nanoparticles SynthesisL.mono-AptamerLTACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA35N/AssDNAListeria Monocytogenes (CICC 21633)Whole cellDeveloped a SERS-based aptasensor using aptamer@AgNPs for the detection of bacteria.N/AN/AN/AN/ABiosensorN/AFAM LabeledN/AN/AN/AN/AN/A
ABdb_0958 281076862017A novel aptasensor for the colorimetric detection of S. typhimurium based on gold nanoparticlesS. typhimurium aptamerTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium)Whole cellColorimetric aptasensor was developed based on color changing GNPs for the detection of S. typhimurium.Quantitative detection of S. typhimurium from 10(2) to 10(7) cfu/mL with a detection limit as low as 56 cfu/mL.N/AN/AN/ABiosensorN/AN/AN/AN/AN/AN/AN/A
ABdb_0959 281079302017A chemiluminescent aptasensor based on rolling circle amplification and Co2+/N-(aminobutyl)-N-(ethylisoluminol) functional flowerlike gold nanoparticles for Salmonella typhimurium detectionS. typhimurium aptamerTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028)Whole cellChemiluminescent aptasensor based on rolling circle amplification (RCA) using Co2+/ABEI-AuNFs-cDNA complex was developed for the detection of S. typhimurium.The limit of detection (LOD) was 10 cfu/mL. The method exhibited excellent selectivity over non-target bacteria.N/AN/AN/ABiosensorN/A3'-Biotinylated (Biotin-TTTTTT)N/AN/AN/AN/AN/A
ABdb_0960 290306712017Graphene-based label-free electrochemical aptasensor for rapid and sensitive detection of foodborne pathogenS. typhimurium aptamerTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium)Whole cellrGO-azophloxine (AP) nanocomposite aptasensor was developed for the detection of foodborne pathogens.Exhibited a linear range of detection from 10(8) to 10(1) cfu/mL with a detection limit of 10(1) cfu/mL.N/AN/AN/ABiosensorN/AN/AN/AAptasensor showed good stability for up to 20 days, with a 5.1% increase in current response when stored in ultrapure water at 4°C.N/AN/AN/A
ABdb_0961 286457562017An aptamer-based PCR method coupled with magnetic immunoseparation for sensitive detection of Salmonella Typhimurium in ground turkeyS. Typhimurium aptamerCAGTCCAGGACAGATTCGCGAGCCCACTCCAAACACGACCAACTCACGCTCTATCAACATCGCTATCCACGTGGATTTCATTCAGCGATT90N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028)Whole cellAptamer-based PCR method coupled with magnetic immunoseparation was developed to detect S. Typhimurium from ground turkey.Able to detect 10(2) CFU/mL of S. Typhimurium in pure culture, and 10(3) CFU/mL of S. Typhimurium in ground turkey.N/AN/AN/ABiosensorN/AN/AN/AN/AN/AN/AN/A
ABdb_0962 295947122017Fluorometric graphene oxide-based detection of Salmonella enteritis using a truncated DNA aptamerSE54FTACCAAAATGTTGGATTGGATGTTGTACTGGGTTGCATAGGTAGTCCAGAAGCC54N/AssDNASalmonella Enteritidis (S. Enteritidis) (ATCC 13076)Whole cellTruncated aptamer was used to develop a fluorometric graphene oxide (GO) based assay for the detection of S. enteriditis.LOD of 38 and 25 cfu/mL for the full length SE54 and SE54T, respectively, with a linear response from 10(2) to 10(7) cfu/mL.N/AFluorescence Spectroscopy6.3 nMDetectionN/A5'-Fluorescein LabeledN/AN/AN/AN/AN/A
ABdb_0963 295947122017Fluorometric graphene oxide-based detection of Salmonella enteritis using a truncated DNA aptamerSE54TGGATTGGATGTTGTACTGGGTTGCATAGG29N/AssDNASalmonella Enteritidis (S. Enteritidis) (ATCC 13076)Whole cellTruncated aptamer was used to develop a fluorometric graphene oxide (GO) based assay for the detection of S. enteriditis.LOD of 38 and 25 cfu/mL for the full length SE54 and SE54T, respectively with a linear response from 10(2) to 10(7) cfu/mL.N/AFluorescence Spectroscopy3.2 nMDetectionN/A5'-Fluorescein LabeledN/AN/ABest CandidateN/AN/A
ABdb_0964 289878792017Thioaptamer targeted discoidal microparticles increase self immunity and reduce Mycobacterium tuberculosis burden in miceCD44 Thioaptamer (CD44TA)GAGATTCATCACGCGCATAGTCTTGGGA*CGGTGTTA*A*A*CGA*A*A*GGGGA*CGA*CCCGA*CTA*TGCGA*TGA*TGTCTTC74N/AssDNAMycobacterium Tuberculosis (M.Tb.)CD44 receptor (Mtb-infected murine macrophages)Develop a targeting system using CD44 thioaptamers (TA)-conjugated discoidal silicon mesoporous microparticles (SMP) to enhance accumulation of these agents/carriers in the infected macrophages in the lungs.CD44TA-SMP treatment increased IP-10 (CXCL-10), MCP-1, MCP-2, and RANTES, with no change in IL-6 release compared to the control.N/AN/AN/ATherapeuticsN/A*= 5'-monothio-dA and 5'-Cyanine5 (Cy5) LabeledIn uninfected murine and human macrophages, SMP and CD44TA-SMP did not affect the cell viability.N/AN/AN/AN/A
ABdb_0965 282877152017Dual-Recognition Förster Resonance Energy Transfer Based Platform for One-Step Sensitive Detection of Pathogenic Bacteria Using Fluorescent Vancomycin-Gold Nanoclusters and Aptamer-Gold NanoparticlesAptamerGCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 29213)Bacterial cell wallDevelop a dual-molecular FRET platform based on the recognition of bacterial cell walls by antibiotic and aptamer molecules, respectively, for the detection of pathogenic bacteria.Shows a linear concentration of Staph. aureus in the range from 20 to 10(8) cfu/mL with a detection limit of 10 cfu/mL.N/AN/AN/ABiosensorN/A5'-Thiolated and Cyanine3 (Cy3) LabeledN/AN/AN/AN/AN/A
ABdb_0966 https://doi.org/10.1016/j.snb.2017.07.0742017A point-of-need enzyme linked aptamer assay for Mycobacterium tuberculosis detection using a smartphoneDirect Dot-Blot AptamerGGCGCCATAGCGACGGGGCCATTCCAAGAA30N/AssDNAMycobacterium Tuberculosis (H37Ra)Mannose-capped lipoarabinomannan (ManLAM) epitopeSmartphone-based method using enzyme-linked aptamers for point-of-need M.tb detection.The direct dot-blot system provided a lower limit of quantitation of 10(4) CFU/mL and greater accuracy.N/AN/AN/ADetectionN/A3'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0967 https://doi.org/10.1016/j.snb.2017.07.0742017A point-of-need enzyme linked aptamer assay for Mycobacterium tuberculosis detection using a smartphoneIndirect Dot-Blot AptamerGCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GGCGCCATAGCGACGGGGCCATTCCAAGAA-GGGTCAATGCGTCATA88N/AssDNAMycobacterium Tuberculosis (H37Ra)Mannose-capped lipoarabinomannan (ManLAM) epitopeSmartphone-based method using enzyme-linked aptamers for point-of-need M.tb detection.The limit of quantitation (LOQ) for indirect assays was 10(5) CFU/mL.N/AN/AN/ADetectionN/AN/AN/AN/AN/AN/AN/A
ABdb_0968 278165852017A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructuresBLA1TCTCCCTTTAGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCTTTTCCCTCT57N/AssDNAEscherichia Coli (E. Coli) O111:B4 and O111:B5Lipopolysaccharide (LPS)Developed a turn-on sensor based on a bulb-like triplex turn-on switch (BTTS) for the detection of lipopolysaccharides.N/AN/AN/AN/ABiosensorN/AN/AN/AN/AN/AN/AN/A
ABdb_0969 278165852017A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructuresBLA 2TCTCTCCCTTTAGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCTTTTCCCTCTCT61N/AssDNAEscherichia Coli (E. Coli) O111:B4 and O111:B5Lipopolysaccharide (LPS)Developed a turn-on sensor based on a bulb-like triplex turn-on switch (BTTS) for the detection of lipopolysaccharides.N/AN/AN/AN/ABiosensorN/AN/AN/AN/AN/AN/AN/A
ABdb_0970 278165852017A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructuresBLA 3TCTCTCTCCCTTTAGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCTTTTCCCTCTCTCT65N/AssDNAEscherichia Coli (E. Coli) O111:B4 and O111:B5Lipopolysaccharide (LPS)Developed a turn-on sensor based on a bulb-like triplex turn-on switch (BTTS) for the detection of lipopolysaccharides.The sensor has a linear calibration range of 1-150 ng/mL and a detection limit of 50 pg/mL, quantitatively, with the portable spectrophotometer, and 20 ng/mL, semi-quantitatively, with the naked eye.N/AN/AN/ABiosensorN/AN/AN/AN/ABest CandidateN/AN/A
ABdb_0971 278165852017A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructuresBLA 4TCTCTCTCTCCCTTTAGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCTTTTCCCTCTCTCTCT69N/AssDNAEscherichia Coli (E. Coli) O111:B4 and O111:B5Lipopolysaccharide (LPS)Developed a turn-on sensor based on a bulb-like triplex turn-on switch (BTTS) for the detection of lipopolysaccharides.N/AN/AN/AN/ABiosensorN/AN/AN/AN/AN/AN/AN/A
ABdb_0972 289106782017Colorimetric aptasensor for the detection of Salmonella enterica serovar typhimurium using ZnFe2O4-reduced graphene oxide nanostructures as an effective peroxidase mimeticsApt 1 (Capture)AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA40N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028)Whole cellThe colorimetric aptasensor platform was developed based on ZnFe2O4/rGO nanostructures, which act as an artificial enzyme (mimetic) that catalyses the oxidation of TMB by H2O2 to detect S. typhimurium.The limit of detection (LOD) of 11 cfu/mL, and the detection range was 11 to 1.10 × 10(5) cfu/mL of S. typhimurium in buffer solution.N/AN/AN/ABiosensorN/A5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0973 289106782017Colorimetric aptasensor for the detection of Salmonella enterica serovar typhimurium using ZnFe2O4-reduced graphene oxide nanostructures as an effective peroxidase mimeticsApt 2 (Signal)AAAAAAAAAAAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA52N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028)Whole cellThe colorimetric aptasensor platform was developed based on ZnFe2O4/rGO nanostructures, which act as an artificial enzyme (mimetic) that catalyses the oxidation of TMB by H2O2 to detect S. typhimurium.Limit of detection (LOD) of 11 cfu/mLN/AN/AN/ABiosensorN/A5'-PolyA (12A)N/AN/AN/AN/AN/A
ABdb_0974 279514522017(1→3)-β-D-glucan aptamers labeled with technetium-99m: Biodistribution and imaging in experimental models of bacterial and fungal infectionSeq6CGACTGACGCCTCCAAGCCACACGTGTGAGAAGGGTGTTATCATGTATTTCGTGTTCCTTTCGTCATTCCTTTGTCTGCATGCATCGCTACGTG94N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 25923)(1 → 3)-β-D-glucansRadiolabeled aptamers were evaluated to identify infectious foci caused by bacterial cells.The target/non-target ratios were 3.17 ± 0.22 for seq6 in S. aureus-infected animals.N/AN/A0.303 ± 0.067 μMImagingN/A5'-Radiolabelled (99mTc labeled)N/AIn vitro stability of seq6 aptamer labelled with 99mTc in the presence of 0.9% saline, plasma, and cysteine excess (molar ratio) was above 84.2 ± 2.9% in all cases at 24hrs.N/AN/AN/A
ABdb_0975 287158742017Detection of bacterial infection by a technetium-99m-labeled peptidoglycan aptamerAntibac1TCGCGCGAGTCGTCTGGGGACAGGGAGTGCGCTGCTCCCCCCGCACGTCCTCCC54N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 25923)PeptidoglycanRadiolabeled aptamers were evaluated for biodistribution studies and scintigraphic imaging in infection‐bearing mice.Achieved a high target-to-non-target (T/NT) ratio of 4.7 ± 0.9 at 1.5 h and 4.6 ± 0.1 at 3.0 h in bacterial-infected models.N/ABinding Assay0.170 ± 0.032 μMImagingN/A5'-Inverted Thymidine (5'-idT), 3'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (99mTc labeled)N/ARadiolabeling yields were superior to 90% and 99mTc‐Antibac1 was highly stable in the presence of saline, plasma, and cysteine up to 6 h.N/ADistribution half-life: 6.7 min and Elimination half-life: 41.3 min.N/A
ABdb_0976 288604622017Development of gold nanoparticle-aptamer-based LSPR sensing chips for the rapid detection of Salmonella typhimurium in pork meatAptamerTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium) (KCTC 2421)Whole cellDevelop a portable LSPR biosensor-based device on gold nanoparticles (AuNPs) for the detection of Salmonella typhimurium in pork meat samples.Limit of detection (LOD) of 10(4) cfu/mL in both pure culture and spiked pork samples, and total analysis time of 30-35 minutes.N/AN/AN/ABiosensorN/A3'-Thiolated (SH-(CH2)3)N/AN/AN/AN/AN/A
ABdb_0977 286246202017AgBr nanoparticles/3D nitrogen-doped graphene hydrogel for fabricating all-solid-state luminol-electrochemiluminescence Escherichia coli aptasensorsE. coli aptamerGCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAEscherichia Coli (E. Coli)Whole cellDeveloped a ECL aptasensor based on amine-functionalized E. coli aptamer and luminol/AgBr/3DNGH for the detection of E. coli.Linear response range from 0.5 to 500 cfu/mL and Limit of Detection (LOD) of 0.17 cfu/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂-(CH2)6)N/ANo obvious change was observed for the response of a BSA/aptamer/GA/CHIT/luminol/AgBr/3DNGH/GCE when stored at 4°C for 12 d, indicating an acceptable stability of the aptasensor.N/AN/AN/A
ABdb_0978 275263402017Aptamer biosensor for Salmonella typhimurium detection based on luminescence energy transfer from Mn2+-doped NaYF4:Yb, Tm upconverting nanoparticles to gold nanorodsS. typhimurium aptamerGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNASalmonella Typhimurium (S. Typhimurium)Whole cellA LET method based on UCNPs and gold nanorods (Au NRs) was developed for the determination of Salmonella typhimurium.Linear range: 12 to 5×10^5 cfu/mL and Limit of Detection (LOD): 11 cfu/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0979 https://doi.org/10.1007/s00604-017-2174-72017Aptamer based voltammetric biosensor for the detection of Mycobacterium tuberculosis antigen MPT64Aptamer 3GTACAAACGACGGCCAGT-CCTTGGGATGATTCAAGCAAAGCCTCACGCCTACGGCTAA-GTCATAGCTGTCTCTCCTG775'-GTACAAACGACGGCCAGT-N40-GTCATAGCTGTCTCTCCTG-3'ssDNAMycobacterium Tuberculosis (M.Tb.)MPT64 proteinDevelop an aptaelectrode based on graphene modified iron-oxide chitosan hybrid (CHIT-IO-GR) nanocomposite film deposited on fluorine tin oxide (FTO) for the detection of the M. tb. specific antigen MPT64.Exhibited a limit of detection (LOD) of 0.9 fg/mL within 20 min and a linear range from 1.0 × 10(5) fg/mL to 1.0 fg/mL.10N/AN/ABiosensorSELEX5'-BiotinylatedN/AThe biosensor retained about 80% of its initial activity after 10 uses and good stability of 17 day.Best CandidateN/AN/A
ABdb_0980 286917952017Copper-Based Metal-Organic Framework Nanoparticles with Peroxidase-Like Activity for Sensitive Colorimetric Detection of Staphylococcus aureusS. aureus aptamerGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus)Whole cellA colorimetric method for the detection of S. aureus was developed using aptamer-modified Cu-MOF nanoparticles.The linear range for S. aureus detection is 50-10,000 CFU/mL, with a detection limit of 20 CFU/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0981 281591082017An enhanced chemiluminescence resonance energy transfer aptasensor based on rolling circle amplification and WS2 nanosheet for Staphylococcus aureus detectionAptamerGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 29213)Whole cellA chemiluminescence resonance energy transfer aptasensor was developed for the detection of S. aureus with Co2+ enhanced N-(aminobutyl)-N-(ethylisoluminol) (ABEI) functional flowerlike gold nanoparticles (Co2+/ABEI-AuNFs) and WS2 nanosheet.The CL signal was found to be linear within the range of 50 cfu/mL to 1.5 × 10(5) cfu/mL, and the limit of detection was 15 cfu/mL.N/AN/AN/ABiosensorN/AN/AN/AN/AN/AN/AN/A
ABdb_0982 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-01CATATCCGCGTCGCTGCGCTCAGACCCACCACTACGCACC405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0983 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-02CATATCCGTGTCGCTGCGCTCAGACCCACCACCACGCACC405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0984 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-03CATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.STC-03 showed better affinity to E. aerogenes, K. pneumoniae, C. freundii, and B. subtilis.18Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)27.2 nM (for E. coli), 11.9 nM (for E. aerogenes), 9.22 nM (for K. pneumoniae), 15.9 nM (for C. freundii), 9.97 nM (for B. subtilis), and 16.4 nM (for S. epidermidis)DetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_0985 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-04ATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC395'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0986 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-05CATATCCGCGTCGCTGCGCTCAGACCCACCACCCGCCC385'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0987 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-06GGGCGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0988 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-07GGGCGGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCG405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0989 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-08GGGCGGGGGTGCTGGGAGAATGGAGTGCTGCGTGCTGCAG405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0990 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-09GGGCAGGTGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0991 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-10AGACCGCAGGTGCACCGGGCGACGTCTCTGGGTGTGGTGA405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0992 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-11AGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0993 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-12GGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.STC-12 showed better affinity to E. coli and S. epidermidis.18Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)38.5 nM (for E. coli), 33.7 nM (for E. aerogenes), 16.3 nM (for K. pneumoniae), 25.6 nM (for C. freundii), 18.9 nM (for B. subtilis), and 13.7 nM (for S. epidermidis)DetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_0994 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-13GGACGCGCGTTGGTGGTGGATGGTGTGTTACACGTGTTGT405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0995 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-14CGGGGTGGGACCAGTCTTGCGCGGGTGAC295'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0996 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-15GGACTGGAGTCTAGACCGGGTAGCTGTGGT305'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0997 https://doi.org/10.1007/s12161-017-0864-82017Fabricating a Novel Raman Spectroscopy-Based Aptasensor for Rapidly Sensing Salmonella typhimuriumS. typhimurium aptamer (STA)TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028)Whole cellDeveloped a surface-enhanced Raman scattering (SERS) based aptasensor with Raman active molecule attached GNRs and cDNA for the detection of Salmonella typhimurium (ST).Observed linear ST concentration from 56 to 56 × 10(7) cfu/mL with a LOD of 9 cfu/mL.N/AN/AN/ABiosensorN/A5'-ThiolatedN/AN/AN/AN/AN/A
ABdb_0998 287955342017Graphene Field-Effect Transistors for the Sensitive and Selective Detection of Escherichia coli Using Pyrene-Tagged DNA AptamerAptamerGCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAEscherichia Coli (E. Coli) (ATCC 8739)Whole cellDeveloped a biosensing platform using graphene field-effect transistors (APG-FETs) with the aid of pyrene-tagged DNA aptamers for E. coli detection.Achieve a detection limit of 10(2) CFU/mL for E. coli within 72 s.N/AN/AN/ABiosensorN/A5'-(pyrene derivate)-TTTTN/AN/AN/AN/AN/A
ABdb_0999 https://doi.org/10.1007/s00604-017-2383-02017Rolling circle amplification based amperometric aptamer/immuno hybrid biosensor for ultrasensitive detection of Vibrio parahaemolyticusVp-aptamerTCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT40N/AssDNAVibrio Parahaemolyticus (ATCC 17802)Whole cellDeveloped an antibody-aptamer-based hetero-sandwich amperometric biosensor for the detection of V. parahaemolyticus.Achieved a range of 2.2 to 2.2 x10(8) cfu/mL, and the limit of detection is as low as 2 cfu/mL.N/AN/AN/ABiosensorN/AN/AN/AAfter 2 weeks of storage at 4°C, the fabricated electrochemical aptasensor retains about 95.2% of its initial sensing current response.N/AN/AN/A
ABdb_1000 https://doi.org/10.1016/j.jelechem.2017.10.0542017Development of an aptasensor using reduced graphene oxide chitosan complex to detect SalmonellaAptamerTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium)Whole cellDeveloped a rGO-CHI electrochemical aptasensor to detect Salmonella.Had a wide detection range of 10(1) to 10(6) CFU/mL with a low limit of detection of 10(1) CFU/mL.N/AN/AN/ABiosensorN/A3'-Thiolated ((C12)-SH) and 5'-Amidation ((C12)-NH₂)N/AN/AN/AN/AN/A
ABdb_1001 https://doi.org/10.1016/j.snb.2017.05.1462017A simple dendrimer-aptamer based microfluidic platform for E. coli O157:H7 detection and signal intensification by rolling circle amplificationAptamerATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT72N/AssDNAEscherichia Coli (E. Coli) O157:H7Whole cellDeveloped a dendrimer-aptamer microfluidic detection system with Rolling circle amplification (RCA) for the detection of E. coli O157:H7 cells.RCA was able to enhance detection signals by up to 50 times, and the limit of detection of the system was reduced to 10(2) cells/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂) and 5'-Cyanine3 (Cy3) LabeledN/AN/AN/AN/AN/A
ABdb_2023 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications4948-1N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85A (Rv3804c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.05 nMBiosensorN/ANapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2024 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications4953-64N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85A (Rv3804c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.06 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2025 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications12073-8N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85A (Rv3804c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.09 nMBiosensorN/ANapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2026 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications12073-32N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85A (Rv3804c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.16 nMBiosensorN/ANapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2027 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications12092-7N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85A (Rv3804c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.06 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2028 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14492-7N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85A (Rv3804c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.24 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2029 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14492-11N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85A (Rv3804c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.21 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2030 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14504-6N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85A (Rv3804c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.29 pM, 0.97 pM, 0.92 pM and 7.3 × 10(6) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.07 nMBiosensorN/APPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2031 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications4949-52N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85B (Rv1886c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay6.39 nMBiosensorN/ANapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2032 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications4954-5N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85B (Rv1886c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.31 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2033 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications12074-5N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85B (Rv1886c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.27 pM, 0.18 pM, 0.30 pM and 5.5 × 10(5) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.08 nMBiosensorN/ANapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2034 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications12074-11N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85B (Rv1886c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.36 pM, 0.72 pM, 0.18 pM and 1.8 × 10(6) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.14 nMBiosensorN/ANapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2035 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications12093-26N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85B (Rv1886c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.26 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2036 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14493-5N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85B (Rv1886c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay1.94 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2037 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14493-16N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85B (Rv1886c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.29 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2038 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14505-57N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85B (Rv1886c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 4.15 pM, 5.13 pM, 55.47 pM and 4 × 10(7) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.13 nMBiosensorN/APPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2039 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications4950-27N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85C (Rv0129c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.36 pM, 1.80 pM, 0.61 pM and 3.4 × 10(8) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.03 nMBiosensorN/ANapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2040 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications4955-49N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85C (Rv0129c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.26 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2041 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications5569-2N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85C (Rv0129c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.23 pM, 0.28 pM, 0.36 pM and 2.6 × 10(7) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.01 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2042 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications5575-1N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85C (Rv0129c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.03 nMBiosensorN/APEdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2043 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications12075-16N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85C (Rv0129c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 7.39 pM, 5.38 pM, 8.51 pM and 4.9 × 10(8) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.05 nMBiosensorN/ANapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2044 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications12075-40N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85C (Rv0129c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.13 nMBiosensorN/ANapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2045 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14494-53N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85C (Rv0129c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.03 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2046 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14494-124N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85C (Rv0129c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.14 pM, 0.07 pM, 0.06 pM and 2.7 × 10(7) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.02 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2047 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14506-48N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85C (Rv0129c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.89 pM, 1.98 pM, 2.10 pM and 3.3 × 10(8) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.04 nMBiosensorN/APPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2048 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14506-76N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)A85C (Rv0129c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.03 nMBiosensorN/APPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2049 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7604-59N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)ACR (Rv2031c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay17.5 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2050 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7616-43N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)ACR (Rv2031c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay20.3 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2051 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14483-8N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)ACR (Rv2031c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay32 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2052 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7610-49N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)CF30 (Rv0577 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay5.41 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2053 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7618-50N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)CF30 (Rv0577 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay2.2 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2054 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications12089-13N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)CF30 (Rv0577 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay1.83 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2055 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7595-51N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)CH10 (Rv3418c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.43 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2056 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7600-67N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)CH10 (Rv3418c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay9.45 nMBiosensorN/ABndU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2057 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7608-61N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)CH10 (Rv3418c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay11.1 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2058 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications12067-1N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)CH10 (Rv3418c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay7.55 nMBiosensorN/ANapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2059 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14488-1N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)CH10 (Rv3418c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.40 pM, 0.84 pM, 1.94 pM and 1.1 × 10(6) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.53 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2060 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14488-3N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)CH10 (Rv3418c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.05 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2061 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7592-57N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)CH602 (Rv0440 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.26 pM, 1.47 pM, 1.98 pM and 3.0 × 10(7) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.46 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2062 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7605-11N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)CH602 (Rv0440 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay1.84 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2063 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14484-4N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)CH602 (Rv0440 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.34 pM, 0.56 pM, 1.20 pM and 2.2 × 10(8) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.5 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2064 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14484-33N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)CH602 (Rv0440 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay3.03 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2065 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14498-14N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)CH602 (Rv0440 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay7.39 nMBiosensorN/APPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2066 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7606-49N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)DNAK (Rv0350 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.59 pM, 1.53 pM, 2.19 pM and 1.6 × 10(7) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.66 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2067 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14486-2N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)DNAK (Rv0350 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.31 pM, 0.78 pM, 3.03 pM and 7.4 × 10(6) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay1.03 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2068 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7612-56N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)ESXA (Rv3875 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay41.4 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2069 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7620-5N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)ESXA (Rv3875 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay54.7 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2070 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications5557-2N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)ESXB (Rv3874 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.12 pM, 0.32 pM, 0.13 pM and 2.2 × 10(6) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.54 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2071 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications5562-95N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)ESXB (Rv3874 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay4.52 nMBiosensorN/APEdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2072 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7598-15N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)KAD (Rv0733 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay1.11 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2073 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications12090-3N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)KAD (Rv0733 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay13.2 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2074 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14491-10N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)KAD (Rv0733 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.20 pM, 1.11 pM, 24.55 pM and 7.9 × 10(7) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.08 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2075 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14491-43N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)KAD (Rv0733 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.14 pM, 0.34 pM, 6.19 pM and 3.5 × 10(7) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.12 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2076 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14502-11N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)KAD (Rv0733 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay1.28 nMBiosensorN/APPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2077 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14502-14N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)KAD (Rv0733 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.83 nMBiosensorN/APPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2078 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14487-46N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MASZ (Rv1837c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay6.6 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2079 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14499-2N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MASZ (Rv1837c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay8.84 nMBiosensorN/APPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2080 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14999-10N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MASZ (Rv1837c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay5.27 nMBiosensorN/ANapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2081 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14999-49N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MASZ (Rv1837c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay4.67 nMBiosensorN/ANapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2082 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications15005-35N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MASZ (Rv1837c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay4.61 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2083 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications15005-42N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MASZ (Rv1837c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay4.08 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2084 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications15013-1N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MASZ (Rv1837c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay8.06 nMBiosensorN/ABndU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2085 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications15013-72N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MASZ (Rv1837c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay8.54 nMBiosensorN/ABndU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2086 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7615-18N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MPT64 protein (Rv1980c)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay12.3 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2087 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14496-43N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MPT64 protein (Rv1980c)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay2.07 nMBiosensorN/APPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2088 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications5560-59N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MPT51 protein (Rv3803c)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay13.9 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2089 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7619-25N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MPT51 protein (Rv3803c)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay11.1 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2090 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14503-5N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MPT51 protein (Rv3803c)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay21.1 nMBiosensorN/APPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2091 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications15001-2N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MTB12 (Rv2376c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.18 pM, 0.11 pM, 0.42 pM and 1.1 × 10(6) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.04 nMBiosensorN/ANapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2092 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications15001-29N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MTB12 (Rv2376c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.06 nMBiosensorN/ANapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2093 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications15001-182N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MTB12 (Rv2376c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.18 pM, 1.68 pM, 0.93 pM and 3.4 × 10(5) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.05 nMBiosensorN/ANapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2094 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications15007-1N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MTB12 (Rv2376c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.24 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2095 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications15007-43N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MTB12 (Rv2376c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.18 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2096 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications15007-48N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)MTB12 (Rv2376c gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.18 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2097 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications5558-86N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)PSTS1 (Rv0934 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay11.5 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2098 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7622-15N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)PSTS1 (Rv0934 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay6.68 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2099 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14485-44N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)PSTS1 (Rv0934 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay5.75 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2100 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14485-59N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)PSTS1 (Rv0934 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay9.1 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2101 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7587-49N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)RL7 (Rv0652 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.26 pM, 2.47 pM, 1.05 pM and 1.2 × 10(8) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.07 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2102 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7596-2N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)RL7 (Rv0652 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.Exhibit LOD of 0.08 pM, 0.70 pM, 1.35 pM and 3.4 × 10(7) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively.N/ARadiolabel Equilibration Binding Assay0.13 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_2103 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications12087-24N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)RL7 (Rv0652 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay11.1 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2104 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14489-14N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)RL7 (Rv0652 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.11 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2105 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14489-18N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)RL7 (Rv0652 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.04 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2106 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications7609-13N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)TPX (Rv1932 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay3.56 nMBiosensorN/ATrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2107 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14490-6N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)TPX (Rv1932 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay0.72 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2108 287941782017Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications14490-127N/AN/AN/AssDNAMycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources)TPX (Rv1932 gene)Slow-off-rate modified aptamer (SOMAmer) for detecting TB.N/AN/ARadiolabel Equilibration Binding Assay1.5 nMBiosensorN/A2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2109 https://doi.org/10.1007/s00604-017-2453-32017Orientation selection of broad-spectrum aptamers against lipopolysaccharides based on capture-SELEX by using magnetic nanoparticlesEA10N/AN/A5'-ATAGGAGTCACGACGACCAG-40N-TATGTGCGTCTACCTCTTGA-3'ssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 50671)Lipopolysaccharide (LPS) lipid A domainIdentify aptamers that bind to the LPS target.N/A15Fluorescence Binding Assay28 ± 4 nMDetectionOrientation selection based on Capture-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_2110 https://doi.org/10.1007/s00604-017-2453-32017Orientation selection of broad-spectrum aptamers against lipopolysaccharides based on capture-SELEX by using magnetic nanoparticlesEA7N/AN/A5'-ATAGGAGTCACGACGACCAG-40N-TATGTGCGTCTACCTCTTGA-3'ssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 50671)Lipopolysaccharide (LPS) lipid A domainIdentify aptamers that bind to the LPS target.EA7 binds to the lipid A region of LPS and exhibits a detection limit of 3 ng/mL and a linear range of 5–250 ng/mL.15Fluorescence Binding Assay102 ± 17 nMDetectionOrientation selection based on Capture-SELEX5'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_2111 https://doi.org/10.1007/s00604-017-2453-32017Orientation selection of broad-spectrum aptamers against lipopolysaccharides based on capture-SELEX by using magnetic nanoparticlesEA5N/AN/A5'-ATAGGAGTCACGACGACCAG-40N-TATGTGCGTCTACCTCTTGA-3'ssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 50671)Lipopolysaccharide (LPS) lipid A domainIdentify aptamers that bind to the LPS target.N/A15Fluorescence Binding Assay149 ± 30 nMDetectionOrientation selection based on Capture-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_2112 287280092017Bridged Rebar Graphene functionalized aptasensor for pathogenic E. coli O78:K80:H11 detectionAnti-E.coli aptamerN/AN/A5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3'ssDNAEscherichia Coli (E. Coli) O78:K80:H11 (MTCC 726)Whole cellA novel fabrication method of functionalised Bridged Rebar Graphene (BRG) onto EIS-based nanostructured aptasensor for label-free detection of E. coli O78:K80:H11.LOD ~ 10(1) cfu/mL with a dynamic response range from 10(1) to 10(6) cfu/mL.12Bio-Layer Interferometry (BLI)14 nMBiosensorPhenylboronic acid (PBA) mediated SELEX5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_2113 https://doi.org/10.1016/j.snb.2017.02.0982017Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonatorsPA05N/AN/AN/AssDNAStreptococcus PneumoniaeSurface-specific Protein PavAGenerated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis.N/A8Enzyme-Linked Oligonucleotide Assay (ELONA)N/ADetectionSELEX5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU))N/AN/AN/AN/AN/A
ABdb_2114 https://doi.org/10.1016/j.snb.2017.02.0982017Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonatorsPA08N/AN/AN/AssDNAStreptococcus PneumoniaeSurface-specific Protein PavAGenerated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis.The polyclonal population PA08 showed a frequency shift four times greater and a faster reaction rate than FH05 when measured on the gravimetric sensor.8Enzyme-Linked Oligonucleotide Assay (ELONA)N/ADetectionSELEX5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU))N/AN/ABest CandidateN/AN/A
ABdb_2115 https://doi.org/10.1016/j.snb.2017.02.0982017Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonatorsFH05N/AN/AN/AssDNANeisseria MeningitidisSurface-specific Protein FHbpGenerated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis.The polyclonal population PA08 showed a frequency shift four times greater and a faster reaction rate than FH05 when measured on the gravimetric sensor.8Enzyme-Linked Oligonucleotide Assay (ELONA)N/ADetectionSELEX5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU))N/AN/ABest CandidateN/AN/A
ABdb_2116 https://doi.org/10.1016/j.snb.2017.02.0982017Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonatorsFH08N/AN/AN/AssDNANeisseria MeningitidisSurface-specific Protein FHbpGenerated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis.N/A8Enzyme-Linked Oligonucleotide Assay (ELONA)N/ADetectionSELEX5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU))N/AN/AN/AN/AN/A
ABdb_2117 283421482017Further characterization and independent validation of a DNA aptamer-quantum dot-based magnetic sandwich assay for CampylobacterAptamerN/AN/AN/AssDNACampylobacter Jejuni (ATCC 29428)Whole cellDeveloped an aptamer-MB and aptamer-QD sandwich assay for the detection of C.jejuni.Establishes a LOD between 5 and 10 C. jejuni cells/mL in sterile buffer (PBS) and chicken rinsate.N/AN/AN/ABiosensorN/A5'-BiotinylatedN/AN/AN/AN/AU.S. Patent No. 9562900