Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 99
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0730 | 27424215 | 2016 | Gold nanoparticle-DNA aptamer conjugate-assisted delivery of antimicrobial peptide effectively eliminates intracellular Salmonella enterica serovar Typhimurium | AptHis (6H7) | GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC | 40 | N/A | ssDNA | Salmonella typhimurium infected HeLa cells | S. typhimurium Whole cell | His-aptamer conjugated AuNP platform for the loading of His-tagged AMP (C-terminally hexahistidine-tagged A3-APO (A3-APOHis) AMPs) to eliminate intracellular S. Typhimurium cells. | 80% viability increase of infected HeLa cells and 100% survival rate of infected mice. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Thiolated (A10-Thiol) and Cyanine5 (Cy5) Labeled | AuNP-Apt(His)-A3-APO(His) led to the increased viability of S. Typhimurium-infected HeLa cells. | ∼80% of A3-APOHis remained in serum after 48 h of incubation with AuNP-Apt(His)-A3-APO(His). | N/A | N/A | N/A |
| ABdb_0731 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL26 | TAGCTCACTCATTAGGCA-CATTTGTGGCACCAAATTTGAATTAATCAAGACAGTGTGGT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | SAL 26 can detect 10(2) CFU/mL in the gold nanoparticle-based colourimetric assay and has a limit of detection (LOD) of 10(3) CFU/mL in the aptamer sedimentation assay. | 10 | Fluorescence Spectroscopy | 123 ± 23 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0732 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL33 | TAGCTCACTCATTAGGCA-CTCGTATTGAGGAGCTCGTATTATTTAATTCACACTGTGCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | 221 ± 72 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0733 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL28 | TAGCTCACTCATTAGGCA-CTCTGTCGTCAACAGTCTAACTTGTAGAATTGATGTTACTG-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | Limit of detection (LOD) of 10(3)CFU/mL in the aptamer sedimentation assay. | 10 | Fluorescence Spectroscopy | 195 ± 46 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0734 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL43 | TAGCTCACTCATTAGGCA-CGAGACCACCGGCAACCTTTCACAAAGGGGAGGCTAA-GCATAGTTAAGCCAGCC | 72 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | 294 ± 112 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0735 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL21 | TAGCTCACTCATTAGGCA-CAGCAACTCGCTTTGATACCGGTAGAGTTTGTATTGCTCAA-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0736 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL37 | TAGCTCACTCATTAGGCA-CTTAGTTCAGACGCGAGTATTATCGGCGTCCAAGCAAGGG-GCATAGTTAAGCCAGCC | 75 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0737 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL20 | TAGCTCACTCATTAGGCA-CATATTCAGCAGTTGTATGATAGCGGGTCGCGAGTGTGTAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0738 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL40 | TAGCTCACTCATTAGGCA-CTGCATTACATATATGGCAGTGGGTTAACCTGGATTGAGGA-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | 204 ± 73 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0739 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL16 | TAGCTCACTCATTAGGCA-CCCGATTGTACTAATGAAGATGGACACTGAGAGGGGGATGG-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0740 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL11 | TAGCTCACTCATTAGGCA-CTCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | Limit of detection (LOD) of 10(3)CFU/mL in the aptamer sedimentation assay. | 10 | Fluorescence Spectroscopy | 184 ± 43 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0741 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL45 | TAGCTCACTCATTAGGCA-CCGTGCCAACTGAGGGATACAGGGGGAGTGTCGGTCTACCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | 294 ± 133 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0742 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL23 | TAGCTCACTCATTAGGCA-CCTCACAGCCCTTCTTCCCGTATTTGTAGACTAGTTACATT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0743 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL48 | TAGCTCACTCATTAGGCA-CCACACTGTCTTGATTTTGGATTTGTCGGTGCTGACCTGTG-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0744 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL9 | TAGCTCACTCATTAGGCA-CTGCGAGTGAACTCCTCCTTTTGTATTTAGTGTGCGGATCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0745 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL29 | TAGCTCACTCATTAGGCA-CATGTGGAGTGCGAACTGTCTGGTCTTATCGGGCTCGCTGT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0746 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B5 | CAGTCCAGGACAGATTCGCGAG-CCCACTCCAAACACGACCAACTCACGCTCTATCAACATCGCTATC-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | LOD was 7.9 × 10(3) CFU/mL and a linear range from 7.9 × 10(2) to 7.9 × 10(6) CFU/mL of S. typhimurium with less than 1 h. | 10 | Quartz Crystal Microbalance (QCM) | 58.5 nM | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0747 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | A24 | CAGTCCAGGACAGATTCGCGAG-GCACAATCCACCTCTCACCGCACGCCACGCACTGCCTCTGTCCCG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | 19.63 nM | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0748 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B30 | AATCGCTGAATGAAATCCACGTG-GGAAGTGTGTGGGTGACCAGAGGTGTGGTGATGGGATTGTCGTA-CCTCGCGAATCTGTCCTGGACTG | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | 51.02 nM | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0749 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B31 | CAGTCCAGGACAGATTCGCGAG-CCGCACCGCCCTATCCTCGTGTCCCTGCCCAACAGCGCCGCCCGC-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0750 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | A37 | CAGTCCAGGACAGATTCGCGAG-GTGGGGCGGGAAAGTGTGTGTAGGTGGTGGCGTTGTCACGGCGGG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0751 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B16 | CAGTCCAGGACAGATTCGCGAG-GGGCTGTGTGAGAAGTGGGTGTGGTGGTGGATATGCAACGTTGTA-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0752 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B21 | CAGTCCAGGACAGATTCGCGAG-GTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0753 | 27529508 | 2016 | A Single ssDNA Aptamer Binding to Mannose-Capped Lipoarabinomannan of Bacillus Calmette-Guérin Enhances Immunoprotective Effect against Tuberculosis | BM2 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CCCCATGAACTAGGCTCCACAATGAGTTTGG-GGGTCAATGCGTCATA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N31-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Bovis (bacillus Calmette–Guérin (BCG)) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identified aptamers against ManLAM and served as an immune enhancer for BCG against M. tb H37Rv infection via blocking MR binding, triggering ManLAM–CD44 signalling, and enhancing M1 macrophage and Th1 activation via cellular surface CD44 in vitro and in vivo. | Ki of BM2 was estimated to be 10.34 ± 0.27 nM, with a LOD of 1 × 10^4 cfu/100 μL of BCG. | 10 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 8.59 ± 1.23 nM | Therapeutics/Immunmodulatory | SELEX | Biotinylated | BM2 was demonstrated to be safe with low toxicity based on in vitro and in vivo toxicity analyses. | BM2–BCG complex could be detected and remained stable for at least 30 days in vivo. | N/A | N/A | N/A |
| ABdb_0754 | 27529508 | 2016 | A Single ssDNA Aptamer Binding to Mannose-Capped Lipoarabinomannan of Bacillus Calmette-Guérin Enhances Immunoprotective Effect against Tuberculosis | BM1 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CGGTCGTAGACCGGGAGTTGTTGTTAGTTCA-GGGTCAATGCGTCATA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N31-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Bovis (bacillus Calmette–Guérin (BCG)) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identified aptamers against ManLAM and served as an immune enhancer for BCG against M. tb H37Rv infection via blocking MR binding, triggering ManLAM–CD44 signalling, and enhancing M1 macrophage and Th1 activation via cellular surface CD44 in vitro and in vivo. | N/A | 10 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0755 | 27529508 | 2016 | A Single ssDNA Aptamer Binding to Mannose-Capped Lipoarabinomannan of Bacillus Calmette-Guérin Enhances Immunoprotective Effect against Tuberculosis | BM4 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CGCGCAGCGGGTCGACTTCATTCCTCACCAT-GGGTCAATGCGTCATA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N31-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Bovis (bacillus Calmette–Guérin (BCG)) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identified aptamers against ManLAM and served as an immune enhancer for BCG against M. tb H37Rv infection via blocking MR binding, triggering ManLAM–CD44 signalling, and enhancing M1 macrophage and Th1 activation via cellular surface CD44 in vitro and in vivo. | N/A | 10 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0756 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S3 | ATACCAGCTTATTCAATT-CCCGCCTCTGAGCATTATTAATGTTATACCTTACGGCTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | Inhibited PBMCs proliferation with an inhibition rate of 84% and reduced IFN-γ, TNF-α, IL-2, and IL-6 secretions by 89%, 87%, 73%, 69%, respectively. PEGS3 allowed 79% of the mice to survive the lethal challenge. | 9 | Enzyme-Linked Aptamer Assay (ELAA) | 36.93 ± 7.29 nM | Therapeutics/Immunmodulatory | SELEX | 5′-Polyethylene glycol (PEG) with 5'-Amidation (NH₂) and 3’-Inverted Thymidine (3'-idT) and 5'-Biotinylated or 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0757 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S6 | ATACCAGCTTATTCAATT-GCCGCGGAATTGTGGCTTGGTGTCGTGGTCAGGGGCTGG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | N/A | 9 | Enzyme-Linked Aptamer Assay (ELAA) | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0758 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S12 | ATACCAGCTTATTCAATT-GCCACTGTGGACTTGTTATTCGTCTTTGCCGTCTAATTCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | Inhibited PBMCs proliferation with an inhibition rate of 84%. | 9 | Enzyme-Linked Aptamer Assay (ELAA) | 79.35 ± 12.09 nM | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0759 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S23 | ATACCAGCTTATTCAATT-GCAACAATGTTGTGTCAGCAAGTTGGTTGGCGGTGTATTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | N/A | 9 | Enzyme-Linked Aptamer Assay (ELAA) | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0760 | https:doi.org10.1016j.carbon.2016.04.014 | 2016 | Biodegradable graphene oxide and polyaptamer DNA hybrid hydrogels for implantable drug delivery | Polyaptamer (PA) | ATCGGCTAGCACGTACAGAACTAAAAAAAAAAAA-GTCGGCTTAGCCTCAACCCCC-AAGGCAAAAAGGCAT | 70 | N/A | ssDNA | Escherichia Coli (E. Coli) and Staphylococcus aureus (S. aureus) | Kanamycin (Kan) | Kan-loaded PA-GO (Kan/PA-GO) hybrid hydrogels for antibacterial effects. | Significantly reduced the viability of E. coli and S. aureus to 24.2 ± 4.8% and 17.7 ± 0.7%, respectively. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-Phosphate | N/A | N/A | N/A | N/A | N/A |
| ABdb_0761 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-52 | CATACGATTTAGGTGACACTATAG-CCGCCCAGCGGGGGTAGGGCCGGACGTAGGAGGAGCTGCG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | P12-52 bound strongly to all three Gram-positive bacteria tested (S. aureus, E. faecalis and E. freudini). | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 11.97 ± 2.94 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0762 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-31 | CATACGATTTAGGTGACACTATAG-CCCTCCGGGGGGGGGGGTCATCGGGATACCTGGTAAGGATA-ATTTCTCCTACTGGGATAGGTGGA | 89 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | The binding of P12-31 was 10-fold stronger than that of the random library. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 87.03 ± 17.32 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0763 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-55 | CATACGATTTAGGTGACACTATAG-CCGGAGGGGGGTGAGGTCTGCGGCAGGCTGTGTGGGTGGA-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | The binding of P12-55 to E. coli cells was more than 100-fold stronger than that of the random library. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 161.0 ± 34.74 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0764 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-17 | CATACGATTTAGGTGACACTATAG-GACGGTGGCAGGGAAAGGGGTCGGGCATATGGCGGAGGGG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | P12-17 could only bind to E. faecalis. The binding of P12-17 was 10-fold stronger than that of the random library. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 56.33 ± 15.87 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0765 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-11 | CATACGATTTAGGTGACACTATAG-CCCTCCGGGGGGGTCATCGGGATACCTGGTAAGGATA-ATTTCTCCTACTGGGATAGGTGGA | 85 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0766 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-21 | CATACGATTTAGGTGACACTATAG-CCGGAGGTGGGTGAGGTCTGCGGCAGGCTGTGTGGGTGGA-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0767 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-9 | CATACGATTTAGGTGACACTATAG-TGCGGGCGGAGGACACGGACCCGTATGGGAGCAATGCACG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0768 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-15 | CATACGATTTAGGTGACACTATAG-GGCCACCCACAGGCACTCCGCTCATGAATCGTGGAGTCGG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0769 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-30 | CATACGATTTAGGTGACACTATAG-CACCACGGACACGATCCCAAGCTAGGAGGTGCGGCGGGGT-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0770 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-48 | CATACGATTTAGGTGACACTATAG-TGGCACAGCACGTCGCACGGTCCCCGGGAGGTGTTCACTG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0771 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-51 | CATACGATTTAGGTGACACTATAG-TCGCGAGTGCGTGTACGCCACACATCACAAAAGGGGTGTG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0772 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-66 | CATACGATTTAGGTGACACTATAG-GGCAACATTCAGACATACCAGTACCCACTCGGACTTCCCG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0773 | 27427891 | 2016 | An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria | E1 | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Composite (TiO2-Apc) for enhanced photodynamic inactivation of target-specific bacteria. | TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation. | N/A | Fluorescence Spectroscopy | 12.4 nM | Therapeutics | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0774 | 27427891 | 2016 | An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria | E2 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Enhanced photodynamic inactivation via aptamer-functionalized TiO₂ particles. | TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation. | N/A | Fluorescence Spectroscopy | 25.2 nM | Therapeutics | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0775 | 27427891 | 2016 | An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria | E10 | GCAATGGTACGGTACTTCCGTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGGCAAAAGTGCACGCTACTTTGCTAA | 90 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Enhanced photodynamic inactivation via aptamer-functionalized TiO₂ particles. | TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation. | N/A | Fluorescence Spectroscopy | 14.2 nM | Therapeutics | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0776 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec3 (31) -Truncated | UUCAAUUGCACGAAUUUGCUGUGUUUUUGGG | 31 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | Ec3(31)-biotin-streptavidin magnetic separation has LOD of 1.3 × 10(6) CFU/ml, Optical analytic technique has LOD of 5 × 10(4) CFU/ml, and Electrochemical Impedance Spectroscopy (EIS) has LOD of 2 × 10(4) CFU/mL of E. coli cells. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 225 nM | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated or Thiolated or Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0777 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec3 | AUACCAGCUUAUUCAAUUGCACGAAUUUGCUGUGUUUUUGGGGGGGUCGGGGAGUAUAAGAUAGUAAGUGCAAUCU | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0778 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec2 | AUACCAGCUUAUUCAAUUCUUCUUUGAUCUGCUCGUAUCAUGGGACGGGAGGGUAUAGAUAGUAAGUGCAAUCU | 74 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0779 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec5 | AUACCAGCUUAUUCAAUUCGAAUUUAAGUUUCUUUUCUGGUAUAGUGGUUGGGUGGGUAAGAUAGUAAGUGCAAUCU | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0780 | 28121169 | 2016 | Development of a DNA aptamer that binds specifically to group A Streptococcus serotype M3 | 12L18A | GCCTGTTGTGAGCCTCCTAAC-TCCTCGAGGGGGGGGGGATGAAAAGGAAAACGCAACAA-CATGCTTATTCTTGTCTCC | 78 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Group A Streptococcus (GAS) serotype M3 | Whole cell | Identify aptamers against S. pyogenes serotype M3. | 74% efficiency toward the S. pyogenes serotype M3. | 12 | Flow Cytometry | 7.47 ± 1.72 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0781 | 28121169 | 2016 | Development of a DNA aptamer that binds specifically to group A Streptococcus serotype M3 | 12L12A | GCCTGTTGTGAGCCTCCTAAC-GAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATA-CATGCTTATTCTTGTCTCC | 78 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Group A Streptococcus (GAS) serotype M3 | Whole cell | Identify aptamers against S. pyogenes serotype M3. | N/A | 12 | Flow Cytometry | 8.25 ± 1.43 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0782 | 27234880 | 2016 | Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates | Aci49 | GCCTGTTGTGAGCCTCCTAAC-TACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCTACTGT-CATGCTTATTCTTGTCTCC | 83 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Identify aptamers against and develop a sandwich enzyme-linked aptamer sorbent assay (ELASA) for the rapid detection of A. baumannii from clinical isolates. | Display detection limit of 10(3) CFU/ml, and the sensitivity of the test toward the clinical isolates was 95.47%. | 12 | Flow Cytometry | 7.547 ± 1.353 pM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0783 | 27234880 | 2016 | Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates | Aci55 | GCCTGTTGTGAGCCTCCTAAC-GTTACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCT-CATGCTTATTCTTGTCTCC | 80 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Identify aptamers against and develop a sandwich enzyme-linked aptamer sorbent assay (ELASA) for the rapid detection of A. baumannii from clinical isolates. | N/A | 12 | Flow Cytometry | 10.70 ± 2:561 pM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0784 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8 | ATACCAGCTTATTCAATT-AGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | PA#2/8 and its truncated variant PA#2/8[S1-58] were able to differentiate between the highly Protein A-producing S. aureus Cowan strain. | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | 101.4 ± 5.9 nM (of 3′-biotinylated) and 189.9 ± 13.0 nM (of 5′-biotinylated) | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0785 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S1-58] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT | 58 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | PA#2/8 and its truncated variant PA#2/8[S1-58] were able to differentiate between the highly Protein A-producing S. aureus Cowan strain. | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | 11.3 ± 1.4 nM (of 3′-biotinylated) and 23.7 ± 2.0 nM (of 5′-biotinylated) | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0786 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S1-50] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTC | 50 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | N/A | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0787 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S1-43] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGG | 43 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | N/A | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0788 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S28-50] | AGGGGGATAGAGGGGGTGGGTTC | 23 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | N/A | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0789 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA1 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0790 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA2 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0791 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA3 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 3'-Pacific Blue | N/A | N/A | N/A | N/A | N/A |
| ABdb_0792 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA4 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0793 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA5 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0794 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA6 | GGGGGGTTTTCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 52 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | The limit of detection (LOD) was as low as 4.5×10(3) cfu/ml, with a linear range of 10(4)-10(7) cfu/ml. | N/A | N/A | N/A | Biosensor | N/A | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0795 | 26334590 | 2016 | Label-free and highly sensitive electrochemical detection of E. coli based on rolling circle amplifications coupled peroxidase-mimicking DNAzyme amplification | Anti-E. coli aptamer | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Label-free electrochemical biosensor using RCA coupled DNAzyme amplification for detecting E. coli. | Exhibits detection limits of 8 cfu/mL and a detection range of 5 orders of magnitude. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0796 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC2 | TGCAGGATCCGGTATCCGTGGACGGTGTGCAGGATCCGGTATCCGTGGGCACGAGAATTCCTCCGTTGCG | 70 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | LOD in the minimum quantity of 5 ng SEB per 100 µl of human serum. | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | 2.3 × 10(−11) M | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0797 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC3 | TGCAGGATCCGGTATCCGTGCACACACACCCAACAACCAGCTGCCGCACCGGAGGAATTCTCGT | 64 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0798 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC7 | TGCAGGATCCGGTATCCGTGGGCGGGGCCATGCAGGATCCGGTATCCGTGGGCCGCAACGGAGGAATCTCGT | 72 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0799 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC8 | CCGTGGCCGCAACGGAGGAATTCTCGT | 27 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0800 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC9 | ACGAGAATTCCTCCGTTGCGGCACAGTTGGGCAGGAACCTGTGGGGCGTGCGCAACGGAGGAATTCTCGT | 70 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0801 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC10 | ACGAGAATTCCTCCGTTGCGGCCCACGGATACC | 33 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0802 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC11 | TGCAGGATCCGGTATCCGTGCGCAACGGAGGAATTCTCGT | 40 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0803 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC12 | ACGAGAATTCCTCCGTTGCGGCCCACGGATACAGGATCCTGCATGCCTGTCCACGGATACCGGATCCTCA | 70 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0804 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC17 | TGCAGGATCCGGTATCCGTGCCAAACACACCAAAAGCCCCCCCAACCCACAACCACGTCC | 60 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0805 | 27318566 | 2016 | Staphylococcus aureus detection in blood samples by silica nanoparticle-oligonucleotides conjugates | Aptamer | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Aptamer-functionalized silica magnetic nanoparticles-based assay for on-site determination of S. aureus. | Detects S. aureus cells as low as 682 CFU in whole blood, with a linear range from 800 CFU/ml blood to 104 CFU/ml blood. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0806 | 26599860 | 2016 | Salmonella typhimurium detection using a surface-enhanced Raman scattering-based aptasensor | Apt1 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A SERS-based aptasensor bearing Au@Ag core/shell nanoparticles (NPs) functionalized with apt 1 and X-rhodamine (ROX)-modified apt 2 was developed for the detection of bacteria. | A calibration curve is obtained in the range of 15 to 1.5 × 10(6) CFU/mL with a limit of detection of 15 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0807 | 26599860 | 2016 | Salmonella typhimurium detection using a surface-enhanced Raman scattering-based aptasensor | Apt2 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A SERS-based aptasensor bearing Au@Ag core/shell nanoparticles (NPs) functionalized with apt 1 and X-rhodamine (ROX)-modified apt 2 was developed for the detection of bacteria. | A calibration curve is obtained in the range of 15 to 1.5 × 10(6) CFU/mL with a limit of detection of 15 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-X-rhodamine (ROX) modified | N/A | N/A | N/A | N/A | N/A |
| ABdb_0808 | 26894987 | 2016 | Diazonium-based impedimetric aptasensor for the rapid label-free detection of Salmonella typhimurium in food sample | Aptamer (N45) | TTTGGTCCTTGTCTTATGTCCAGAATGCGAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAAATTTCTCCTACTGGGATAGGTGGATTAT | 96 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (OMP) | Developed a label-free impedimetric aptamer-based biosensor for S. typhimurium detection. | Rapid (30 min) detection with a concentration range of 1×10(1) to 1×10(8) CFU/mL and limit of detection (LOD) of 6 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0809 | 27411775 | 2016 | Rapid and Selective Detection of Pathogenic Bacteria in Bloodstream Infections with Aptamer-Based Recognition | Apt-S. aureus | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACTTTTTTTTT | 71 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Aptamer-based capture platform using Fe3O4@mTiO2 magnetic nanoparticles for the detection of bacteria. | Display a favourable bacterial-capture efficiency of about 80% even at low infectious doses (10–2000 CFU/mL). | N/A | N/A | N/A | Detection | N/A | 3'-Amidation (NH₂-(CH2)7) and 3'-FAM Labeled ((CH2)7-FAM) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0810 | 27411775 | 2016 | Rapid and Selective Detection of Pathogenic Bacteria in Bloodstream Infections with Aptamer-Based Recognition | Apt-E. coli | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTATTTTTTTTTT | 81 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Aptamer-based capture platform using Fe3O4@mTiO2 magnetic nanoparticles for the detection of bacteria. | Display a favourable bacterial-capture efficiency of about 80% even at low infectious doses (10–2000 CFU/mL). | N/A | N/A | N/A | Detection | N/A | 3'-Amidation (NH₂-(CH2)7) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0811 | 27404735 | 2016 | Highly sensitive detection of lipopolysaccharides using an aptasensor based on hybridization chain reaction | Detection probe | GTCGAATGCTCTGCCTGGAAGAGTTGTTAGCAGGGA | 36 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 | Lipopolysaccharide (LPS) | Developed an aptasensor assay based on hybridization chain reaction (HCR) to detect LPS. | Display a relatively low detection limit (1.73 ng/mL) with a linear response range of 1–10(5) ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0812 | 26641108 | 2016 | Dual Recognition Strategy for Specific and Sensitive Detection of Bacteria Using Aptamer-Coated Magnetic Beads and Antibiotic-Capped Gold Nanoclusters | SA-aptamer | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Aptamer-coated magnetic beads (Apt-MB) and Van-functionalized fluorescent gold nanoclusters (AuNCs@Van) were employed for specific capture of SA. | Sensitive quantification of SA in the range of 32–10(8) cfu/mL with the detection limit of 16 cfu/mL via fluorescence intensity. | N/A | N/A | N/A | Biosensor | N/A | 5′-Biotinylated and 5′-Cyanine3 (Cy3) and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0813 | 27427591 | 2016 | Duplex Identification of Staphylococcus aureus by Aptamer and Gold Nanoparticles | SA23 | GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Develop an aptamer-AuNPs-based colorimetric method for duplex identification of S. aureus. | AuNPs as a sensor could well distinguish S. aureus from S. enteritidis and P. mirabilis. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0814 | 26768582 | 2016 | DNA aptamers for the detection of Haemophilus influenzae type b by cell SELEX | Clone 63 | GCCTGTTGTGAGCCTCCTAAC-AGGAGGCGAACGGGCAGGTTCTTGGGGAGACAAGAATAAG-CATGCTTATTCTTGTCTCC | 80 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Haemophilus Influenzae type b (Hib) (ATCC 10211) | Whole cell | Identify an aptamer against Hib for the detection of H. influenzae. | Clone 63 could detect Hib in patients’ CSF samples at 60 CFU/mL. | 7 | Flow Cytometry | 28.46 pM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0815 | 26768582 | 2016 | DNA aptamers for the detection of Haemophilus influenzae type b by cell SELEX | Clone 2, 42, 45 | GCCTGTTGTGAGCCTCCTAAC-GCCAGGTGTTTTGGCGGTAGGGGTGAAACAACAGGGGG-CATGCTTATTCTTGTCTCC | 78 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Haemophilus Influenzae type b (Hib) (ATCC 10211) | Whole cell | Identify an aptamer against Hib for the detection of H. influenzae. | N/A | 7 | Flow Cytometry | 47.10 pM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0816 | 27063716 | 2016 | Magnetic Nanoparticles-based Aptasensor Using Gold Nanoparticles as Colorimetric Probes for the Detection of Salmonella typhimurium | S. typhimurium aptamer | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor for S. typhimurium detection using gold nanoparticles (AuNPs) and magnetic nanoparticles (MNPs). | The assay shows a linear response over a range of 25 to 10(5) cfu/mL, and the detection limit was improved to 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for Apt1) and 5'-Biotinylated (for Apt2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0817 | 26971274 | 2016 | Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection | S. aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Dual-excitation aptasensing platform based on the luminescent nanoparticles (QDs and UCNPs) for the detection of Salmonella typhimurium and Staphylococcus aureus. | Linear detection range: 50 to 10⁶ cfu/mL; LOD: 16 cfu/mL (S. aureus). | N/A | N/A | 35 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0818 | 26971274 | 2016 | Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Dual-excitation aptasensing platform based on the luminescent nanoparticles (QDs and UCNPs) for the detection of Salmonella typhimurium and Staphylococcus aureus. | Linear detection range: 50 to 10⁶ cfu/mL; LOD: 28 cfu/mL (S. typhimurium). | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0819 | 27209574 | 2016 | A paper based graphene-nanocauliflower hybrid composite for point of care biosensing | RNA Aptamer | GGGUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAUAGAUAGUAA | 64 | N/A | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | O-antigen | Develop electrochemical biosensing platform using graphene paper functionalized with fractal platinum nanocauliflower for detection of E. coli O157:H7. | Detection limit (LOD) of ~4 CFU/mL with linear range of 4 to 10(5) CFU/mL and a response time of 12 min. | N/A | N/A | 110 nM | Biosensor | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0820 | https://doi.org/10.1021/acssensors.6b00333 | 2016 | Quantitative Label-Free Listeria Analysis Based On Aptamer Modified Nanoporous Sensor | LM Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes | Whole cell | Developed a nanoporous sensor with aptamer combined porous anodic aluminium oxide membrane for detection of L. monocytogenes. | Achieved detection within 10 min, with a high sensitivity of 100 CFU/mL and a good linear range between 100 and 1250 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5′-CHO | N/A | N/A | N/A | N/A | N/A |
| ABdb_0821 | https://doi.org/10.1016/j.foodcont.2015.11.031 | 2016 | Vibrio parahaemolyticus detection aptasensor using surface-enhanced Raman scattering | Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | A SERS-based aptasensor was developed using Au@Ag core-shell nanoparticles for the detection of V. parahaemolyticus. | Achieved a concentration in the linear range of 10–10(6) cfu/mL, with a limit of detection of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt 1) and 5'-Cyanine3 (Cy3) Labeled (for apt 2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0822 | https://doi.org/10.1039/C6AY02623K | 2016 | SERS aptasensor detection of Salmonella typhimurium using a magnetic gold nanoparticle and gold nanoparticle based sandwich structure | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50761) | Whole cell | Developed a SERS aptasensor using aptamer-functionalized magnetic gold nanoparticles (MGNPs) and mercaptobenzoic acid (4-MBA) functionalized gold nanoparticles (GNPs) based sandwich structure for the detection of S. typhimurium. | Exhibit a good linear range from 10 cfu/mL to 10(7) cfu/mL, and the LOD is 5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2017 | 27151293 | 2016 | Identification of ssDNA aptamers specific to clinical isolates of Streptococcus mutans strains with different cariogenicity | H19 | N/A | N/A | 5'-GCAATGGTACGGTACTTCC-45N-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Streptococcus Mutans | Whole cell | Identify a high-affinity aptamer against cariogenic S. mutans strains. | Aptamer H19 showed strong binding, as indicated by higher fluorescence intensity, with Strains 12 and 17 compared with other strains. | 9 | Flow Cytometry | 69.45 ± 38.53 nM | Detection | Subtractive SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2018 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T9 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | Specificity and sensitivity were 95.31% and 83.00% (for 100 aPTB serum samples), 98.70% and 92.71% (for 96 aPTB sputum samples), and 94.44% and 88.71% (for 62 EPTB serum samples), respectively. | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 668 ± 159 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2019 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T25 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 685 ± 131 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2020 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T14 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 815 ± 144 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2021 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T15 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 736 ± 207 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2022 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T6 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 998 ± 207 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |