Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 164
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0197 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-3 (80nt) | CTCCTCTGACTGTAACCACG-TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0198 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-3 (60nt) | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 7.8 ± 6.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0199 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-6 (79nt) | CTCCTCTGACTGTAACCACG-TAACGTACCAAAATGTTGGATTGGATGTTGTACTGGGTT-GCATAGGTAGTCCAGAAGCC | 79 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 53 ± 7 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0200 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-6_54 | TACCAAAATGTTGGATTGGATGTTGTACTGGGTTGCATAGGTAGTCCAGAAGCC | 54 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 6.3 ± 0.58 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0201 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-20_80 | CTCCTCTGACTGTAACCACG-CACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 28 ± 3.8 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0202 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-20_60 | CTCCTCTGACTGTAACCACGCACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis and 43 ± 4% (SE-20, 60nt) in S. enteritidis. | 12 | Flow Cytometry | 7.1 ± 0.62 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0203 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-22_80 | CTCCTCTGACTGTAACCACG-TATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 30 ± 4.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0204 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-22_60 | CTCCTCTGACTGTAACCACGTATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 5.3 ± 0.7 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0205 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-11_60 | CTCCTCTGACTGTAACCACGAACGATTCAAGAACTGTTGGTTGTCGGCTTATTTTCGCCA | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 6.9 ± 0.4 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0206 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-34_80 | CTCCTCTGACTGTAACCACG-TGCCGCTAAACGCCGGCTCATCGTTATGCTTTTCATTGCA-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 56 ± 7.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0207 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-1_40 | GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC | 39 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0208 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-6_60 | GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTCGCATAGGTAGTCCAGAAGCC | 61 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0209 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-12_80 | CTCCTCTGACTGTAACCACG-GTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGTC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0210 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-12_60 | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT | 59 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium and 62 ± 12% (ST-12, 60nt) in S. typhimurium. | 12 | Flow Cytometry | 4.5 ± 0.4 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0211 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-20_80 | CTCCTCTGACTGTAACCACG-ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCATC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0212 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-20_40 | ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCAT | 40 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0213 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-33_60 | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | 51.0 ± 4.3 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0214 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST2P | ATAGGAGTCACGACGACCAGAA-AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | The limit of detection (LOD) was 25 cfu/mL, and the percentage gated fluorescence intensity above library background was 20% when ST9P was incubated with L. monocytogenes cells and 72% when incubated with S. typhimurium. | 9 | Flow Cytometry | 6.33 ± 0.58 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0215 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST2 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 82 ± 2.34% for ST2. | 9 | Flow Cytometry | 16.34 ± 0.45 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0216 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST3P | ATAGGAGTCACGACGACCAGAA-TTTCGGCTAAGGACGGGTGAAATACATTTAATAGGGTGGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | N/A | 9 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0217 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST7P | ATAGGAGTCACGACGACCAGAA-TAAGTACAGGACTGGAGTATTAGCGGGGTCCATGCAAGGC-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | N/A | 9 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0218 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST9 | AATCAATAGAAGACAAAGTCCGAAACAGGTGTGACGGTAA | 40 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 72 ± 1.57% for ST9. | 9 | Flow Cytometry | 9.45 ± 0.63 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0219 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST9P | ATAGGAGTCACGACGACCAGAA-AATCAATAGAAGACAAAGTCCGAAACAGGTGTGACGGTAA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 66 ± 1.45% for ST9P. | 9 | Flow Cytometry | 11.14 ± 0.12 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0220 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C4 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-ACGGGCGTGGGGGCAATGCCTGCTTGTAGGCTTCCCCTGTGCGCG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | C4 showed strong specific binding to S. Typhimurium, and the increase in the fluorescence intensity of C4 was less than 30% against E. coli and S. aureus. | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0221 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C1 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGTCGGAGCCAGGATGCGAGGTCTGTAGGTCTGCGGGCGG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0222 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C2 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-ACGGCGGGCGAGTTGACGGCGTAATCGTGCTGCCGCGTG-GGTGGATCCATATTCCTACTCG | 99 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0223 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C3 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGGGCGTGGCTCAGAGTGGGGGTCGGTCAGTCTTGTGCGCG-GGTGGATCCATATTCCTACTCG | 102 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0224 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C5 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGACGCCTGCGTGGCTGAGGCTTCGGTCTGCGCCG-GGTGGATCCATATTCCTACTCG | 101 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0225 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C6 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CGTGCGGCGGGCAGGATGGGATGCTGTAGGTCTGCGGGCGCGCG-GGTGGATCCATATTCCTACTCG | 104 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0226 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C7 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CGTGCGGAGCCAGGATGGGAGGTCTGTAGGTCTGCGGGGCGCG-GGTGGATCCATATTCCTACTCG | 103 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0227 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C8 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGGGACGGGTACCGGGCGTGTGGCGTGCCTGCCGCG-GGTGGATCCATATTCCTACTCG | 99 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0228 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C9 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-ACGTGCGGGCCGGATGGGAGCTCTGTAGGTTGCGGGCGCGG-GGTGGATCCATATTCCTACTCG | 101 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0229 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | CA1/SA-1 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGGGGCCAGGATGCGA-GGTGGATCCATATTCCTACTCG | 82 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0230 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | CA2/SA-2 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GGTCTGTAGGTCTGCGGCGCGCG-GGTGGATCCATATTCCTACTCG | 83 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0231 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | CA3/SA-3 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGGGGCCAGGATGCGAGGTCTGTAGGTCTGCGGCGCGCG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0232 | 23698275 | 2013 | Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes | Apt22 | GAATTCAGTCGGACAGCG-ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGCG-GATGGACGAATATCGTCTCCC | 80 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | ssDNA | Salmonella Paratyphi A | Whole cell | Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe. | LOD of the method was 10(3) cfu/mL with a range from 10(3) to 10(7) cfu/mL, and detection signals of target bacteria were 4.4-fold higher than S. Enteritidis, 4.3-fold higher than S. Arizonae, 56.3-fold higher than S. aureus, and 24.3-fold higher than E. coli K88. | 17 | Fluorescence Spectroscopy | 47 ± 3 nM | Biosensor | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0233 | 23698275 | 2013 | Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes | Apt10 | GAATTCAGTCGGACAGCG-GATGATGGACGTATATCGTCTCCCATGAATTCAGTCGGACAGCG-GATGGACGAATATCGTCTCCC | 83 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | ssDNA | Salmonella Paratyphi A | Whole cell | Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe. | N/A | 17 | Fluorescence Spectroscopy | 73 ± 9 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0234 | 23698275 | 2013 | Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes | Apt 45 | GAATTCAGTCGGACAGCG-ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGC-GATGGACGAATATCGTCTCCC | 79 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | ssDNA | Salmonella Paratyphi A | Whole cell | Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe. | N/A | 17 | Fluorescence Spectroscopy | 68 ± 6 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0235 | 23698275 | 2013 | Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes | Apt 60 | GAATTCAGTCGGACAGCG-CGCCCACCCATAATGGATCAGGGCGGGCACCACGATG-GATGGACGAATATCGTCTCCC | 76 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | ssDNA | Salmonella Paratyphi A | Whole cell | Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe. | N/A | 17 | Fluorescence Spectroscopy | 56 ± 9 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0236 | 23689505 | 2013 | Rapid single cell detection of Staphylococcus aureus by aptamer-conjugated gold nanoparticles | SA17 | TCCCTACGGCGCTAAC-CCCCCCAGTCCGTCCTCCCAGCCTCACACC-GCCACCGTGCTACAAC | 62 | 5'-TCCCTACGGCGCTAAC-N30-GCCACCGTGCTACAAC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC: 6538DR) | Whole cell | Identify aptamers that binds to and recognize strains of S.aureus using aptamer-conjugated gold nanoparticles. | LOD was 312 bacterial cells, and the lower limit of detection of the instrument was 63 ± 21 GNPs/μl for 100-nm particles and 508 ± 176 GNPs/μl for 60-nm particles. | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 35 nM and 3.03 nM for SA17-GNPs | Biosensor | Whole Cell-SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0237 | 23689505 | 2013 | Rapid single cell detection of Staphylococcus aureus by aptamer-conjugated gold nanoparticles | SA61 | TCCCTACGGCGCTAAC-CTCCCAACCGCTCCACCCTGCCTCCGCCTC-GCCACCGTGCTACAAC | 62 | 5'-TCCCTACGGCGCTAAC-N30-GCCACCGTGCTACAAC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC: 6538DR) | Whole cell | Identify aptamers that binds to and recognize strains of S.aureus using aptamer-conjugated gold nanoparticles. | LOD was 1250 bacterial cells, and the lower limit of detection of the instrument was 63 ± 21 GNPs/μl for 100-nm particles and 508 ± 176 GNPs/μl for 60-nm particles. | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 129 nM and 9.9 nM for SA61-GNPs | Biosensor | Whole Cell-SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0238 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA1 | ATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA | 75 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA1 and DTMRSA3 showed the best specificity for MRSA. | 17 | Flow Cytometry | 1.6 ± 0.5 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0239 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA2 | ATCCAGAGTGACGCAGCA-CGACACGTTAGGTTGGTTAGGTTGGTTAGTTTCTTG-TGGACACGGTGGCTTA | 70 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA2 and DTMRSA4 bound to all three types of clinical bacterial strains. | 17 | Flow Cytometry | 2.0 ± 0.6 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0240 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA3 | ATCCAGAGTGACGCAGCA-GTAGATGGTTTGGTTGGTGTGGTTTCCTACTGATGTTGGG-TGGACACGGTGGCTTAGTA | 77 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA1 and DTMRSA3 showed the best specificity for MRSA. | 17 | Flow Cytometry | 1.3 ± 0.5 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0241 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA4 | ATCCAGAGTGACGCAGCA-TTATGGGGTGTGGTGGGGGGTTAATGCGTTGGTTATCCG-TGTGGACACGGTGGCTTA | 75 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA2 and DTMRSA4 bound to all three types of clinical bacterial strains. | 17 | Flow Cytometry | 9.5 ± 2 × 10(1) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0242 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 1 | GCAATGGTACGGTACTTCC-CAACCCCGTCTATCACGTCGCTCTTGCGTTGGTTG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 7.5 ~ 10 nM (for ALS) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0243 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 2 | GCAATGGTACGGTACTTCC-CAACCCCGTCTATCACGTCGCTGTTGCGTTGGTTG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 7.5 ~ 10 nM (for ALS) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0244 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 3 | GCAATGGTACGGTACTTCC-CGCCGCCGCGTTCTCATCGCGTGATGTAGTGTCCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 17.5 ~ 20 nM (for ALS) and 30 ~ 35 nM (for 3O-C12-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0245 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 4 | GCAATGGTACGGTACTTCC-CGCCGGCTTCTCTTGCCGTGATGTAGTGTCCG-CAAAAGTGCACGCTACTTTGCTAA | 75 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 15 nM (for ALS) and 20 ~ 25 nM (for 3O-C12-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0246 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 5 | GCAATGGTACGGTACTTCC-CGGGGCCCGCTTCTGGTGCGGTGTACTAGTGACCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | ALSap-5 at 0.5 µM, about 90% of biofilm, 50.9% reduced pyocyanin secretions, as well as secretions of LasA protease and LasB elastase were inhibited. | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 10 ~ 12.5 nM (for ALS) and 20 nM (for 3O-C12-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | Best Candidate | N/A | N/A |
| ABdb_0247 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 6 | GCAATGGTACGGTACTTCC-CGGGGCGGGCTGTCATGCCCATCCTACCGTGACCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 15 ~ 17.5 nM (for ALS) and 45 ~ 50 nM (for C4-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0248 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 7 | GCAATGGTACGGTACTTCC-CGGGGCGGCCTGTGTTGGCCTACCTAGCGAGACCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 12.5 ~ 15 nM (for ALS) and 35 ~ 40 nM (for C4-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0249 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 8 | GCAATGGTACGGTACTTCC-CGCTGCCCCCTGTCCTGGGTTAGCTAGCGAGAGCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | 86% of pyocyanin secretion was inhibited by 6 µM of ALSap-8, and biofilm formation, and the secretions of LasA protease and LasB elastase were also decreased by 9.3%, 17.5%, and 19% respectively. | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 10 nM (for ALS) and 25 ~ 30 nM (for C4-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | Best Candidate | N/A | N/A |
| ABdb_0250 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-17 | AGTATACGTATTACCTGCAGC-GAGGGAAGAAGGGCCAGCACAGATCAGATCAATCGCTCCG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | Lbi-17 showed maximum binding of 78.7 ± 12.38% with an LOD of the combined AMC-qPCR method of 1.8 log10 CFU/500μl L.monocytogenes and ranged from 26% to 77%. | 6 | Flow Cytometry | 35.7 ± 8.02 μM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0251 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-16 | AGTATACGTATTACCTGCAGC-AAATACTTTAGATCTAAGAGTGTTTCGAAAAGACAACAGA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0252 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-118 | AGTATACGTATTACCTGCAGC-TTGAATTAATAGATTAGTATACTTGGGAATCGTCCTAATA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0253 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-200 | AGTATACGTATTACCTGCAGC-AGGAAGACAAATTCCGCCAAAAAGTGGATATAACCAATAA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0254 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-203 | AGTATACGTATTACCTGCAGC-ATAGAGTAGAAGCTACACTACGTAATCACAGACAGATCCA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0255 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A15 | GGGAGCTCAGAATAAACGCTCAA-TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | Display a LOD of 75 CFU/mL and a wide linear range from 10(2) to 10(7). | 8 | Fluorescence Spectroscopy | 48.74 ± 3.11 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0256 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A1 | GGGAGCTCAGAATAAACGCTCAA-GGGGGGCCTAGACTAGGGGGAGAGGGTGGGACGGT-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 86.41 ± 3.34 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0257 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A10 | GGGAGCTCAGAATAAACGCTCAA-GGGGCGGCGGCGGTGGTACGGGGTTGGGAGCGGGC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 203.12 ± 1.86 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0258 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A9 | GGGAGCTCAGAATAAACGCTCAA-GGCGTATGCGCAGCGAGGGCGGCCGGGCGACGTCG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 88.36 ± 3.60 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0259 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A8 | GGGAGCTCAGAATAAACGCTCAA-CCACGGGAACAACATCGTGGCAGGGACGAGCGTCCT-TTCGACATGAGGCCCGGATC | 79 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 120.91 ± 2.85 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0260 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A4 | GGGAGCTCAGAATAAACGCTCAA-GCGCGCTGCCGACGCGGGGGGGCTGATTAGCGTGG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 205.83 ± 1.65 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0261 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A13 | GGGAGCTCAGAATAAACGCTCAA-ACTGAGGGGCGGCGGACGGGATGGGAAATGTAGG-TTCGACATGAGGCCCGGATC | 77 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 299.94 ± 1.67 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0262 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A12 | GGGAGCTCAGAATAAACGCTCAA-TAGCGTGGGTAACCGTGTTGGGGGGTGCCACGGTC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 63.41 ± 3.39 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0263 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A1 | AGCAGCACAGAGGTCAGATG-AGGCGATTACGCTTCTTGTACTTCAATAACGACTCAACTC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | 92.17 ± 16.75 nM | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0264 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A15/40 | AGCAGCACAGAGGTCAGATG-TACTTATGCATTTCCTCCCACGATCTTATTTGAGAGTGAC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | Limit of detection of 8.7±10(-3) μg/mL with linear range of 0.01-10 μg/mL SEA. | 12 | Fluorescence Spectroscopy | 48.57 ± 6.52 nM | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0265 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A23.2 | AGCAGCACAGAGGTCAGATG-ATGATCGTAGTCATTTAAAATTTGAATACTATCAAAGTTA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | 235.00 ± 79.05 nM | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0266 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A3 | AGCAGCACAGAGGTCAGATG-TACGAGCGGTGGTTTTACCCTGCAATACTTTTGGCTGTTA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0267 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A25 | AGCAGCACAGAGGTCAGATG-ATAGATTTTTTTCATGATTCTTCATTTTTTTATTTGAAAC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0268 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A29 | AGCAGCACAGAGGTCAGATG-TATTATCTTACTACGTTGCATCCTACTTTTATAGTCCCCT-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0269 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A30 | AGCAGCACAGAGGTCAGATG-GGATCTTCCCTCAATGTTTATTGTATATCTGTACTCGTAA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0270 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A10 | AGCAGCACAGAGGTCAGATG-TCCAATTCAATTCATTTCTGAACTTAGTCGGCACTTTGAC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0271 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A4 | AGCAGCACAGAGGTCAGATG-CTCCAGCAGCCTCATAGATACGTCGTATCTATTGTTTCCA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0272 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A23.1 | AGCAGCACAGAGGTCAGATG-AAGGTCTTACATCAATTTATATATTTTTCCAATATCTGTC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0273 | 23676911 | 2013 | In vitro selection of RNA aptamer specific to Salmonella typhimurium | Clone I-2 | GGGAGAGCGGAAGCGUGCUGGG-UAGUGUGAGAGCCGUGAGUGAAAGGCCGCGACAAAGAUCGGA-CAUAACCCAGAGGUCGAUGGUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 15277) | OmpC protein | Identify an RNase-resistant RNA aptamer that binds to the OmpC protein of S. Typhimurium. | Bound only to Sal.Typhimurium, but not to S. aureus, E. coli O157:H7 and to that does not express the OmpC protein. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20.27 ± 4.372 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0274 | 23676911 | 2013 | In vitro selection of RNA aptamer specific to Salmonella typhimurium | Clone I-2 Truncated 43-mer | GUGAGAGCCGUGAGUGAAAGGCCGCGACAAAGAUCGGAC | 39 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 15277) | OmpC protein | Identify an RNase-resistant RNA aptamer that binds to the OmpC protein of S. Typhimurium. | Bound only to Sal.Typhimurium, but not to S. aureus, E. coli O157:H7 and to that does not express the OmpC protein. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 27.64 ± 4.784 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0275 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #2 | GGGAGAGCGGAAGCGUGCUGGGCC-GGGAGUUUUGAUACGGCUUCAUGCAGUAAUGUUUUUAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 88 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | The level of binding of #2 RNA aptamer to S. aureus was 1.6-fold higher than that of the control aptamer. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0276 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #10 | GGGAGAGCGGAAGCGUGCUGGGCC-GUUAAUACGGUGUCUUUUUCGGUCGUGUAUAAAACGGAAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0277 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #14 | GGGAGAGCGGAAGCGUGCUGGGCC-UAGGACAGUUCGUCCUCAUUACAUCGCCGCCUAACACAUC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0278 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #16 | GGGAGAGCGGAAGCGUGCUGGGCC-UUAGAAGUAGCCUGCUACGCAUGGUCGACUCAAGAAUCG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0279 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #18 | GGGAGAGCGGAAGCGUGCUGGGCC-UCCGAACAGCGGAAGGUGGUUCGAAGUUGGGGCUUUGGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0280 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #21 | GGGAGAGCGGAAGCGUGCUGGGCC-AGUCUGACACGUAGACAGUUCUAUUACUUACGUCGAGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 88 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0281 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #23 | GGGAGAGCGGAAGCGUGCUGGGCC-ACAGUGUUCUAAUGCGACAAUGGAGUCUGUGGCAAAGUGU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0282 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #24 | GGGAGAGCGGAAGCGUGCUGGGCC-UCUCAGGCCGACAUUCUGAGAACGCGAGGCGUAUUGAAG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0283 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #26 | GGGAGAGCGGAAGCGUGCUGGGCC-UUCAAGUAGGGGCGGUUUACUAUCUGGAUCUUGUAGUUAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0284 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #07 | GGGAGAGCGGAAGCGUGCUGGGCC-ACUUGGGGACGACGAGUAGAUAGUAAGGUGGAGACCUGGU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0285 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #06 | GGGAGAGCGGAAGCGUGCUGGGCC-UAUGACAUAAGGUGGGCUGGGAAGCUAGAGCAUGUAAGG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0286 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #05 | GGGAGAGCGGAAGCGUGCUGGGCC-GUGAAGAAAAAGGGGCGGAUUGGGUAGUAGGGAGGAGAUC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0287 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #04 | GGGAGAGCGGAAGCGUGCUGGGCC-AGGAUAGGGGAUGAAGAAAAAAAGAAGGGUGCCGUGGCGC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0288 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone G1 | GGGAGAGCGGAAGCGUGCUGGGCC-UCCGAACAGCGGAAGGUGGUUCGAAGUUGGGGCUUUGGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0289 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA101 | ATTACTTACGCTATCTAAttt-GGGGGGTGGGTTGTTTGGGATGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0290 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA102 | ATTACTTACGCTATCTAAttt-GGGGGGGGAACATGTTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | 3.5 nM (for B4) and 1.4 nM (for DL1d-A6) | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0291 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA103 | ATTACTTACGCTATCTAAttt-GGGGCGGGACTTATTTGGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0292 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA104 | ATTACTTACGCTATCTAAttt-GGGGGTGGGTGCTTTTGTGGTGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0293 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA105 | ATTACTTACGCTATCTAAttt-TAGGGGTGGGTTCAATTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0294 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA106 | ATTACTTACGCTATCTAAttt-GGGGGGCGGGTATTAATGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0295 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA107 | ATTACTTACGCTATCTAAttt-GTTTTCGTGGGGGGGTGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0296 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA108 | ATTACTTACGCTATCTAAttt-GCACTAAAGGGGAGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0297 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA109 | ATTACTTACGCTATCTAAttt-TTGCTTTAGGGGAGGTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | 7.7 nM (for B4) and 4.1 nM (for DL1d-A6) | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0298 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA110 | ATTACTTACGCTATCTAAttt-TCGCTGATGGGGAGGAGGGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0299 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA111 | ATTACTTACGCTATCTAAttt-GCCCGATGGGGGTGGCGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0300 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G02 | ATTACTTACGCTATCTAAttt-TTGCTGTAGGGGAGGAGGGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Displayed the highest specificity, exhibiting a 36% higher specificity index than that of the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0301 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G19 | ATTACTTACGCTATCTAAttt-TTTTTCGGGGGGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0302 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G14 | ATTACTTACGCTATCTAAttt-TTGCTTTAGAGGAGGCGGGTGGAG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0303 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G11 | ATTACTTACGCTATCTAAttt-TCGGTGATGGGGAGGAGGCGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0304 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G03 | ATTACTTACGCTATCTAAttt-GTTTTATGGGGGTGGCGTGTGGCG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0305 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G06 | ATTACTTACGCTATCTAAttt-TCGCTGATGGGGAGGAGCGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0306 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G10 | ATTACTTACGCTATCTAAttt-TTACTTTTGGGGGGGCGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0307 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G02 | ATTACTTACGCTATCTAAttt-GCACGTTTGGGGAGGTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0308 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G09 | ATTACTTACGCTATCTAAttt-TTTTTCGAGGGGAGATTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0309 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G20 | ATTACTTACGCTATCTAAttt-GCGCGAGTGGGGGGGTGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0310 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G04 | ATTACTTACGCTATCTAAttt-GCCCGCGTCGGGGGGTGGGGGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0311 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G01 | ATTACTTACGCTATCTAAttt-TCGCTATGGGGGTGGCGGCTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0312 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G17 | ATTACTTACGCTATCTAAttt-TAGCTTTAGGGGTCGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0313 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G08 | ATTACTTACGCTATCTAAttt-GAGCTTTAGAGGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0314 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G04 | ATTACTTACGCTATCTAAttt-TTCCTTGGGGAGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0315 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G06 | ATTACTTACGCTATCTAAttt-GTTTTCGGGGGCTGGTGGTTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0316 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G09 | ATTACTTACGCTATCTAAttt-TGGCTCGGGGGGTGTTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0317 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E1 | GCAATGGTACGGTACTTCC-ACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 12.4 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0318 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E2 | GCAATGGTACGGTACTTCC-CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 25.2 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0319 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E10 | GCAATGGTACGGTACTTCC-GTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGG-CAAAAGTGCACGCTACTTTGCTAA | 90 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 14.2 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0320 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E12 | GCAATGGTACGGTACTTCC-GCGAGGGCCAACGGTGGTTACGTCGCTACGGCGCTACTGGTTGAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 16.8 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0321 | https:doi.org10.1007s13765-013-3019-7 | 2013 | Potential of fluorophore labeled aptamers for Pseudomonas aeruginosa detection in drinking water | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Whole cell | Develop a fluorophore-labelled aptamer to detect P. aeruginosa in drinking water. | The limit of detection for P. aeruginosa was 5.07 cells/mL, with a linear dynamic range of 5.64 to 100 cells/mL. | N/A | N/A | N/A | Biosensor | N/A | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0322 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S 1 | ATAGGAGTCACGACGACCAGAA-CGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGGCAGGG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Identify an aptamer targeted against Shigella dysenteriae and develop a sandwich-type fluorescent bioassay for quantification. | Obtained linear range between 10(2)-10(7) cfu/mL of S. dysenteriae, and the limit of detection was 50 cfu/mL | 8 | Fluorescence Binding Assay | 23.47 ± 2.48 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0323 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S12 | ATAGGAGTCACGACGACCAGAA-CCTGGCGGGTCCCGGGGTAAACGGCACAAACGATAAAGAA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0324 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S2 | ATAGGAGTCACGACGACCAGAA-AAGATGACACTTGGCAGCCGCCTCGAGTGTCCTACACGCA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0325 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S8 | ATAGGAGTCACGACGACCAGAA-GCCAGATGAGGCCGGCAGGGCCCAAGTGTTGCTCGGGCTA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0326 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S21 | ATAGGAGTCACGACGACCAGAA-TGCACGGGACAAGAGTACACGCCGATTGCCAGGCACAGTG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | 75.49 ± 3.74 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0327 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S10 | ATAGGAGTCACGACGACCAGAA-GGGGAAGCCGATCAGGCCAATCATTGAGGGTGAACTAGCT-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0328 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S19 | ATAGGAGTCACGACGACCAGAA-TTATCGGCTGGCAAAACTGCGGCTGGAGCTCACAACTAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0329 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S13 | ATAGGAGTCACGACGACCAGAA-TCAGCGAGGGCCAATTAGAAGGGTACTCATGTCTGTGGAC-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0330 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S24 | ATAGGAGTCACGACGACCAGAA-CCAGGCGGAATGTGTCTTCGTTTTGCGAGTGTTAAGGGCG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0331 | 23494620 | 2013 | Selection of DNA aptamers for capture and detection of Salmonella Typhimurium using a whole-cell SELEX approach in conjunction with cell sorting | S8-7 | GTATACGTATTACCTGCAGC-CTGATGTGTGGGTAGGTGTCGTTGATTTCTTCTGGTGGGG-CGATATCTCGGAGATCTTGC | 80 | 5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (Strain S913) | Whole cell | Identifying aptamers selected by whole-cell SELEX and developing a qPCR-based capture-detection platform for Salmonella Typhimurium. | N/A | 10 | Flow Cytometry | 1.73±0.54 μM | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0332 | 23494620 | 2013 | Selection of DNA aptamers for capture and detection of Salmonella Typhimurium using a whole-cell SELEX approach in conjunction with cell sorting | S8-46 | GTATACGTATTACCTGCAGC-CTTGGGCGGTTGGTGTGATGGGCTTTTTTCGTTGGGCCGG-CGATATCTCGGAGATCTTGC | 80 | 5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (Strain S913) | Whole cell | Identifying aptamers selected by whole-cell SELEX and developing a qPCR-based capture-detection platform for Salmonella Typhimurium. | Achieved a Lower Limit of Detection (LOD) of 10(2)-10(3) CFU in a 290-μl sample, and the mean capture efficiency ranged from 3.6% to 12.6%. | 10 | Flow Cytometry | 0.74±0.20 μM | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0333 | 23872060 | 2013 | Carbon nanotube-based aptasensors for the rapid and ultrasensitive detection of bacteria | A1 | GGGAACAGUCCGAGCCUCACUGUUAUCCGAUAGCAGCGCGGGAUGAGGGUCAAUGCGUCAUAGGAUCCCGC | 71 | N/A | ssRNA | Salmonella Typhi (CECT 409) | Type IVB Pili structural proteins | Develop a potentiometric biosensor based on carbon nanotubes (transducer layer) and aptamers (sensing layer) for the detection of bacteria. | Display linear range from 0.2 CFU/mL (1 CFU in 5 mL PBS) to 10(6) CFU/mL of ST and LOD of 0.2 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0334 | 23872060 | 2013 | Carbon nanotube-based aptasensors for the rapid and ultrasensitive detection of bacteria | A2 | GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU | 81 | N/A | ssRNA | Escherichia Coli (E. Coli) (CECT 675) | Type IVB Pili structural proteins | Develop a potentiometric biosensor based on carbon nanotubes (transducer layer) and aptamers (sensing layer) for the detection of bacteria. | Display linear range from 4 to 10(4) CFU/mL and LOD of 4 CFU/mL, and the signal was stable after 120 s. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0335 | 23872060 | 2013 | Carbon nanotube-based aptasensors for the rapid and ultrasensitive detection of bacteria | A3 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CECT 4630) | Type IVB Pili structural proteins | Develop a potentiometric biosensor based on carbon nanotubes (transducer layer) and aptamers (sensing layer) for the detection of bacteria. | Display linear range from 8 × 10(2) CFU/mL–10(8) CFU/mL with LOD of 8 x10(2) CFU/mL and the signal was stable for at least one hour. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0336 | 24267076 | 2013 | A dual-color flow cytometry protocol for the simultaneous detection of Vibrio parahaemolyticus and Salmonella typhimurium using aptamer conjugated quantum dots as labels | Apt1 | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer-modified QDs (QD-apt) were developed to selectively capture and simultaneously detect the target bacteria. | For V. parahaemolyticus cells, a linear range of 3.4 × 10(4) to 3.4 × 10(7) cfu/mL was obtained with QD 535-apt 1-FCM, and a detection limit of 5 × 10³ cfu/mL was achieved. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0337 | 24267076 | 2013 | A dual-color flow cytometry protocol for the simultaneous detection of Vibrio parahaemolyticus and Salmonella typhimurium using aptamer conjugated quantum dots as labels | Apt2 | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-modified Quantum Dots (QD-apt) were developed for selective bacterial capture. | For S. typhimurium, a linear range obtained between the concentrations 3.8 × 10(4) to 3.8 × 10(7) cfu/mL was obtained with QD 585-apt 2-FCM, and a detection limit of 5 × 10³ cfu/mL was achieved. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0338 | 23929394 | 2013 | A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection | L. acidophilus (FALA) | ATCCGTCACACCTGCTCTACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTATGGTGTTGGCTCCCGTAT | 73 | N/A | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Whole cell | Developed an aptamer-functionalized graphene oxide (GO) nano-biosensor for multiplexed pathogen detection. | Detection limits (LOD) of 11.0 cfu/mL (L. acidophilus). | N/A | N/A | 13 nM | Biosensor | N/A | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0339 | 23929394 | 2013 | A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection | S. aureus (FASA) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed an aptamer-functionalized graphene oxide (GO) nano-biosensor for multiplexed pathogen detection. | Detection limits (LOD) of 800.0 cfu/mL (S. aureus) and linear ranges of 10(4)–10(6) cfu/mL. | N/A | N/A | 35 nM | Biosensor | N/A | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0340 | 23929394 | 2013 | A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection | S. enterica (FASE) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-functionalized graphene oxide (GO) nano-biosensor for multiplexed pathogen detection. | Detection limits (LOD) of 61.0 cfu/mL (S. enterica) and linear ranges of 42.2–675.0 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0341 | https://doi.org/10.1016/j.snb.2013.01.062 | 2013 | A label-free DNA aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins | ECA I | GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGC | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC® 8739™) | Outer membrane protein (OMP) | Developed a label-free aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins (OMPs). | Demonstrated in a dynamic detection range of 1 × 10(-7)–2 × 10(-6) M. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0342 | https://doi.org/10.1016/j.snb.2013.01.062 | 2013 | A label-free DNA aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins | ECA II | ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC® 8739™) | Outer membrane protein (OMP) | Developed a label-free aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins (OMPs). | Demonstrated in a dynamic detection range of 1 × 10(-7)–2 × 10(-6) M. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1970 | 23381690 | 2013 | Selection of aptamers against inactive Vibrio alginolyticus and application in a qualitative detection assay | Pool of enriched aptamers | N/A | N/A | 5'-TCAGTCGCTTCGCCGTCTCCTTC-N35-GCACAAGAGGGAGACCCCAGAGGG-3' | ssDNA | Vibrio Alginolyticus | Whole cell (Inactivated) | Identify aptamers against and qualitatively detect inactive Vibrio alginolyticus using PCR. | V. alginolyticus could be detected at 100 cells/ml. | 15 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 27.5 ± 9.2 nM | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1971 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4936–4 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 3.1 nM | Detection | SELEX | 5-tyrosylaminocarbonyl-dU (TyrdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1972 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4939–280 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 1.6 nM | Detection | SELEX | 5-naphthylmethylaminocarbonyl-dU (NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1973 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4943–51 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | Developed toxin assays show a limit of detection of 1 pmol/L (300 pg/mL) and a 3-log dynamic range. | 8 | Equilibrium Binding Assay | 1.3 nM | Detection | SELEX | 5-tyrosylaminocarbonyl-dU (TyrdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1974 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5564–89 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 9.8 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1975 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5570–54 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 6.6 nM | Detection | SELEX | 5-phenylethyl-1-aminocarbonyl (PEdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1976 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4937–55 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.76 nM | Detection | SELEX | 5-tyrosylaminocarbonyl-dU (TyrdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1977 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4938–17 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.45 nM | Detection | SELEX | 5-benzylaminocarbonyl-dU (BndU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1978 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4940–23 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | Developed toxin assays show a limit of detection of 1 pmol/L (300 pg/mL) and a 3-log dynamic range. | 8 | Equilibrium Binding Assay | 0.07 nM | Detection | SELEX | 5-naphthylmethylaminocarbonyl-dU (NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1979 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4944–30 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.08 nM | Detection | SELEX | 5-tryptaminocarbonyl-dU (TrpdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1980 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5566–74 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.04 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1981 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5573–4 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.07 nM | Detection | SELEX | 5-phenylethyl-1-aminocarbonyl (PEdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1982 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4758–6 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, A chain (CdtA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.22 nM | Detection | SELEX | 5-tryptaminocarbonyl-dU (TrpdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1983 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5574–49 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, A chain (CdtA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 1.1 nM | Detection | SELEX | 5-phenylethyl-1-aminocarbonyl (PEdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1984 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5579–11 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, A chain (CdtA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.05 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1985 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5579–12 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, A chain (CdtA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | Developed toxin assays show a limit of detection of 1 pmol/L (300 pg/mL) and a 3-log dynamic range. | 8 | Equilibrium Binding Assay | 0.69 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1986 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5556–51 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, B chain (CdtB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 6.9 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1987 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5556–67 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, B chain (CdtB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 4.4 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |