Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 84
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0124 | 22310030 | 2012 | Development of RNA aptamers for detection of Salmonella Enteritidis | S25 | GGGUUCACUGCAGACUUGACGAAGCUU-GAGAGAUGCCCCCUGAUGTGCAUUCUUGUUGUGUUGCGGC-AAUGGAUCCACAUCTACGAAUUC | 90 | 5'-GGGUUCACUGCAGACUUGACGAAGCUU-N40-AAUGGAUCCACAUCUACGAAUUC-3' | ssRNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify an aptamer that binds to the outer membrane protein C and specifically recognizes S. enteritidis without any cross-reactivity to other Salmonella serovars. | Fluorescence intensity of S. Enteritidis enhanced as the concentration of the aptamer S25 increased from 5 to 30 μg. | 10 | Flow Cytometry | N/A | Detection | Magnetic Bead (MB)-based SELEX | 5'-Fluoro-labeled with Fluorescein-maleimide | N/A | N/A | N/A | N/A | N/A |
| ABdb_0125 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A3P | ATAGGAGTCACGACGACCAGAA-TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | Showed a high binding affinity of 76% for V. parahemolyticus and a low apparent binding affinity of 4% for other bacteria. | 9 | Flow Cytometry | 16.88 ± 1.92 | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0126 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A1 | TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG | 40 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A1 was 64%. | 9 | Flow Cytometry | 22.92 ± 4.72 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0127 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A1P | ATAGGAGTCACGACGACCAGAA-TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A1P was 67%. | 9 | Flow Cytometry | 21.45 ± 2.62 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0128 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A3 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A3 was 75%. | 9 | Flow Cytometry | 24.03 ± 5.18 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0129 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A17P | ATAGGAGTCACGACGACCAGAA-AGGCCGGCCCCTCTGAACTAGATGCAGGGGAGGCGAGCGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0130 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A18P | ATAGGAGTCACGACGACCAGAA-GCGGGCAGCTCCACCGGTAGGCTCCGAGTCATCACGGTCG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A18P was 62%. | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0131 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A21P | ATAGGAGTCACGACGACCAGAA-TTTTGACGAAGTCAGTGCGTCGAAGCGCAAGCATTACAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0132 | 22438927 | 2012 | A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B | APT(SEB1) | GGTATTGAGGGTCGCATC-CACTGGTCGTTGTTGTCTGTTGTCTGTTATGTTGTTTCGT-GATGGCTCTAACTCTCCTCT | 78 | 5'-GGTATTGAGGGTCGCATC-N40-GATGGCTCTAACTCTCCTCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to SEB and quantification of all of the SEs in S. aureus contaminated food. | Have an affinity and high selectivity for SEB. | 14 | N/A | N/A | Detection | SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0133 | 22438927 | 2012 | A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B | APT(SEB2) | GGTATTGAGGGTCGCATC-CCGTAGTGTGTTCTTATTCGTGTCTGTGTGTGTTCTGTCG-GATGGCTCTAACTCTCCTCT | 78 | 5'-GGTATTGAGGGTCGCATC-N40-GATGGCTCTAACTCTCCTCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to SEB and quantification of all of the SEs in S. aureus contaminated food. | N/A | 14 | N/A | N/A | Detection | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0134 | 22218972 | 2012 | Development of aptamer beacons for rapid presumptive detection of Bacillus spores | BAS-6F | ATACGGGAGCCAACACCATCCCTCTTAGGATACAAAGCCAAACTGAGCCCGTGCAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Bacillus Anthracis (BA) (nonpathogenic Sterne strain) | Anthrose and Whole B. anthracis spores | Aptamer beacon that specifically binds to the Bacillus spores. | Limit of detection (LOD) of approximately 30,000 to 60,000 B. anthracis spores per ml. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-TYE 665 dye and 3'-Iowa Black end labels | N/A | N/A | N/A | N/A | N/A |
| ABdb_0135 | 22218972 | 2012 | Development of aptamer beacons for rapid presumptive detection of Bacillus spores | BAS-6R | ATCCGTCACACCTGCTCT-GCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGGA-TGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Bacillus Anthracis (BA) (nonpathogenic Sterne strain) | Anthrose and Whole B. anthracis spores | Aptamer beacon that specifically binds to the Bacillus spores. | Limit of detection (LOD) of approximately 30,000 to 60,000 B. anthracis spores per ml. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-TYE 665 dye and 3'-Iowa Black end labels | N/A | N/A | N/A | N/A | N/A |
| ABdb_0136 | 23190695 | 2012 | Aptasensors for rapid detection of Escherichia coli O157:H7 and Salmonella typhimurium | A1 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC 21530) | Whole cell | Aptasensors based on label-free aptamers and gold nanoparticles (AuNPs) for the detection of E. coli O157:H7 and Salmonella typhimurium. | Detects as low as 10(5) CFU/ml of target bacteria within 20 min or less, with 100% specificity. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0137 | 23190695 | 2012 | Aptasensors for rapid detection of Escherichia coli O157:H7 and Salmonella typhimurium | A2 | CCAAAGGCTACGCGTTAACGTGGTGTTGG | 29 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CMCC 50115) | Whole cell | Aptasensors based on label-free aptamers and gold nanoparticles (AuNPs) for the detection of E. coli O157:H7 and Salmonella typhimurium. | Detects as low as 10(5) CFU/ml of target bacteria within 20 min or less, with 100% specificity. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0138 | 22520654 | 2012 | Evaluation of the clinical value of ELISA based on MPT64 antibody aptamer for serological diagnosis of pulmonary tuberculosis | MPT64-A1 | GGGAGCTCAGAATAAACGCTCAAA-GGGAGCTCAGAATAAACGCTCAAAAACGCTCAAGAGGCCCGGATCTTCGACATGAGGCCCGGATC-CGACATGAGGCCCGGATC | 107 | 5'-GGGAGCTCAGAATAAACGCTCAAA-N35-CGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | MPT64 antibody | Identify aptamers against MPT64 antibody and develop a sandwich ELISA for the serological diagnosis of pulmonary TB (PTB). | LOD was 2.5 mg/L, with a linear range varying from 10 mg/L to 800 mg/L. | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0139 | 22154169 | 2012 | Label-free detection of Staphylococcus aureus in skin using real-time potentiometric biosensors based on carbon nanotubes and aptamers | NH2-Aptamer | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A single-walled carbon nanotube (SWCNT) functionalized with an aptamer-based biosensor to detect Staphylococcus aureus in real-time. | With covalent functionalization, the minimum concentration detected was 8 × 10(2) CFU/mL; with the non-covalent approach, it was 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0140 | 22154169 | 2012 | Label-free detection of Staphylococcus aureus in skin using real-time potentiometric biosensors based on carbon nanotubes and aptamers | Pyr-Aptamer | GCAATGGTACGGTACTTCCGCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTATCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A single-walled carbon nanotube (SWCNT) functionalized with an aptamer-based biosensor to detect Staphylococcus aureus in real-time. | With covalent functionalization, the minimum concentration detected was 8 × 10(2) CFU/mL; with the non-covalent approach, it was 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 3'-C3-Pyr | N/A | N/A | N/A | N/A | N/A |
| ABdb_0141 | 22444566 | 2012 | Dual-color upconversion fluorescence and aptamer-functionalized magnetic nanoparticles-based bioassay for the simultaneous detection of Salmonella Typhimurium and Staphylococcus aureus | Aptamer1 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50761) | Whole cell | Developed a luminescent bioassay for the simultaneous detection of S. Typhimurium and S. aureus using aptamer-conjugated MNPs and UCNPs (NaY0.78F4:Yb0.2, Tm0.02 UCNPs modified aptamer 1 and NaY0.28F4:Yb0.70, Er0.02 UCNPs modified aptamer 2). | Display linear range of 10(1)-10(5) cfu/mL with a limit of detection of 5 cfu/mL for S. Typhimurium. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0142 | 22444566 | 2012 | Dual-color upconversion fluorescence and aptamer-functionalized magnetic nanoparticles-based bioassay for the simultaneous detection of Salmonella Typhimurium and Staphylococcus aureus | Aptamer2 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a luminescent bioassay for the simultaneous detection of S. Typhimurium and S. aureus using aptamer-conjugated MNPs and UCNPs (NaY0.78F4:Yb0.2, Tm0.02 UCNPs modified aptamer 1 and NaY0.28F4:Yb0.70, Er0.02 UCNPs modified aptamer 2). | Display linear range of 10(1)-10(5) cfu/mL with a limit of detection of 8 cfu/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0143 | 23145045 | 2012 | An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7 | E17F-72 | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0144 | 23145045 | 2012 | An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7 | E17F-37 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7. | Could detect cellular concentrations in a range of 10^4 to 10^8 CFU/ml within 2 hours with a detection limit of 10(4) CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0145 | 23145045 | 2012 | An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7 | E18R-72 | ATACGGGAGCCAACACCATTCTATCGTTCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGGAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0146 | 23145045 | 2012 | An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7 | E18R-42 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7. | Could detect cellular concentrations in a range of 10^4 to 10^8 CFU/ml within 2 hours with a detection limit of 10(4) CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0147 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B1 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAACCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | Achieved a linear detection range of 0.01 to 1 ng/mL of LPS with a detection time of less than 15 minutes. | 3 | Surface Plasmon Resonance (SPR) | 20 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0148 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B2 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 12 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0149 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B3 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGTTGGCCAGATGATATAAAGGGTCAACCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 32 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0150 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B4 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAACCCCCCG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 21 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0151 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B5 | CTTCTGCCCGCCTCCTTCC-CTAAGCACAGGGAAACCAGCTAATGAGTTAGGCCTGTCCCCCACG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 484 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0152 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B6 | CTTCTGCCCGCCTCCTTCC-CAATGGACCTATTCGAGTACTGAATAGAACAGTCGGCGCTCTGGG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 298 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0153 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B7 | CTTCTGCCCGCCTCCTTCC-TTCAAGACGATGCCTGGCGCGAGTTACACACTTGCATGGAGCTGG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 61 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0154 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B8 | CTTCTGCCCGCCTCCTTCC-ATCCAATACCTCAGAACTCAGTTCGAGTCGTAAAGGGGAATCGCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 71 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0155 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B9 | CTTCTGCCCGCCTCCTTCC-ACCGATCCATCGAGTTTCTGAGAAAGGCCCGGAGAAACCGCGAGA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 15 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0156 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B10 | CTTCTGCCCGCCTCCTTCC-TCAATCTAACCATGCATGCAGTTTAGGCAGGATTCGTTATCGCAA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 2336 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0157 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-1 | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTG | 46 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0158 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-2 | ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCAT | 40 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0159 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-3 | GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC | 39 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | Successfully detect S. typhimurium down to 600 CFU/mL (equivalent to 18 live cells in 30 μL of assay volume) and distinguish it from other Salmonella species, including S. enteritidis and S. choleraesuis. | 12 | Flow Cytometry | 25 nM | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0160 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-4 | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0161 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-5 | GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTCGCATAGGTAGTCCAGAAGCC | 61 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0162 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-6 | CTCCTCTGACTGTAACCACG-GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGCC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0163 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-7 | CTCCTCTGACTGTAACCACG-GTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGTC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0164 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-8 | CTCCTCTGACTGTAACCACG-GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0165 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-9 | CTCCTCTGACTGTAACCACG-ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCATC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0166 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | E06 | TGATCCGGGCCTCATGTCGAACCCACACCCCACAACCACCCAGCCCCAGCCCGCTATTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0167 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | F04 | TGATCCGGGCCTCATGTCGAACACAACACCCAGCCAACGACCACAACTCCAACTCATTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0168 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | C10 | TGATCCGGGCCTCATGTCGAAACCACAACCCAACAACAAGAACCACAAAGAGCCCCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0169 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | B06 | TGATCCGGGCCTCATGTCGAACACACACAGAACCACAACCACTAAACACGAGGGCCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0170 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | B10 | GATCCGGGCCTCATGTCGAACACCCCCCAACTAAAACAACAAAACACCACCGCCATTGAGCGTTTATTCTGAGCTCCCA | 79 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | Digoxigenin-B10 bound to the Salmonella O8 target with high specificity, producing a clear fluorescent signal within 1.5–2 h. | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 32.04 nM | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0171 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | C04 | TGATCCGGGCCTCATGTCGAACCAACAAGGCAGAAAGAAACCGACAAACCGCACTGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0172 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | F05 | TGATCCGGGCCTCATGTCGAACCAACAAGGCAGAAAGAAACCGACAAACCGCACTGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0173 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | B05 | TGATCCGGGCCTCATGTCGAACCGAACGACTCAAAGATCAAGCCAAGCCACGCCCGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0174 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | G05 | TGATCCGGGCCTCATGTCGAACCAACCCAACACCAAAGAGACCACCACCACACGAGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 175.9 nM | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0175 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | D04 | TGATCCGGGCCTCATGTCGAACACGAGCCACCAACGCACCAAAACCCGTCCTCCACTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0176 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | E04 | TGATCCGGGCCTCATGTCGAAGGCACGCGCACCAAAACACAAACTCCCCCCGCACCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0177 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | G06 | TGATCCGGGCCTCATGTCGAAGGGCCACCTAACCACCTCTGCCAATACCCCCCGCGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0178 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | C05 | TGATCCGGGCCTCATGTCGAAGGGAAGTCATGGCATGGATGCGCTCCCCGCCCACCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0179 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | C06 | TGATCCGGGCCTCATGTCGAAGGGAAGTCATGGCATGGATGCGCTCCCCGCCCACCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0180 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | H05 | TGATCCGGGCCTCATGTCGAACGGCGCAGTGACACGGTAGGGAGTCGTGCCGCGGCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0181 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | H06 | TGGGAGCTCAGAATAAACGCTCAAGGTGGGCGGGCGGCGTTGCTGTTCTTTTGCTGGTGTTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0182 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | F06 | TGGGAGCTCAGAATAAACGCTCAAGAGGCGGCCTGTTCGCTTGTTGTGGGTCCGCTTGGTTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0183 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | A05 | TGGGAGCTCAGAATAAACGCTCAAGGGCACTGGGTGGTGATGTTTTGTTTGTCTGGCGGTTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0184 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | D06 | TGGGAGCTCAGAATAAACGCTCAAGGGGGGGGTGGAGGGGTATGCAGTTTCGGTGGCCGTTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0185 | 22226327 | 2012 | Bio-capture of S. Typhimurium from surface water by aptamer for culture-free quantification | Sal aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-based bio-capture assay for the detection of selective serovar species through molecular-beacon-based real-time PCR. | Achieved a detection limit of 1 CFU/PCR or 100 CFU/ml. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0186 | https://doi.org/10.1002/elan.201100700 | 2012 | A Rapid and Sensitive Aptamer-Based Electrochemical Biosensor for Direct Detection of Escherichia Coli O111 | L9F | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O111 | Lipopolysaccharide (LPS) | Developed an electrochemical biosensor based on target-induced aptamer displacement for the detection of E. coli O111. | Achieved a detection limit of 112 CFU/mL in PBS and 305 CFU/mL in milk within 3.5 hours. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0187 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-1 | CTCCTCTGACTGTAACCACG-CACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0188 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-2 | CTCCTCTGACTGTAACCACG-TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0189 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-3 | CTCCTCTGACTGTAACCACG-TATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0190 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-4 | CTCCTCTGACTGTAACCACG-TGCCGCTAAACGCCGGCTCATCGTTATGCTTTTCATTGCA-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0191 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-5 | CTCCTCTGACTGTAACCACG-TAACGTACCAAAATGTTGGATTGGATGTTGTACTGGGTT-GCATAGGTAGTCCAGAAGCC | 79 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0192 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-6 | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0193 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-7 | CTCCTCTGACTGTAACCACGTATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0194 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-8 | CTCCTCTGACTGTAACCACGAACGATTCAAGAACTGTTGGTTGTCGGCTTATTTTCGCCA | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0195 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-9 | CTCCTCTGACTGTAACCACGCACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | Can successfully detect S. enteritidis down to 600 CFU/mL (equivalent to 18 CFU in 30 μL assay volume) in 10 min and distinguish it from other Salmonella species, including S. typhimurium and S. choleraesuis. | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-6-hydroxyhexyl disulfide group (5'-/5ThioMC6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0196 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-10 | TACCAAAATGTTGGATTGGATGTTGTACTGGGTTGCATAGGTAGTCCAGAAGCC | 54 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1959 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.11 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | CSIR 2.11 achieved 100% sensitivity and 68.75% specificity in detecting antigen in sputum samples. | 6 | Surface Plasmon Resonance (SPR) | 8 ± 1.07 nM | Detection | SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1960 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.19 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | N/A | 6 | Surface Plasmon Resonance (SPR) | 1.6 ± 0.5 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1961 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.2 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | N/A | 6 | Surface Plasmon Resonance (SPR) | 21.5 ± 4.3 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1962 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.15 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | N/A | 6 | Surface Plasmon Resonance (SPR) | 12 ± 1.6 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1963 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.21 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | N/A | 6 | Surface Plasmon Resonance (SPR) | 10.2 ± 3.4 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1964 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK2 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Significantly decreased macrophage invasion from 64.58% (without aptamers) to 33.02% (with 10th aptamer pool), and 26.01% (with NK2). | 10 | Flow Cytometry | 31 ± 4 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1965 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK1 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 48 ± 13 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1966 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK7 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 35 ± 9 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1967 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK8 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 107 ± 44 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1968 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK10 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 95 ± 28 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1969 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK20 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 55 ± 16 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |