Year : 2011

Total records found: 39

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0085	21381755	2011	Aptamer-mediated inhibition of Mycobacterium tuberculosis polyphosphate kinase 2	PPK2 G9	CCGTAATACGACTCACTATAGGGGAGCTCGGTACCGAATTC-AACACATAGGTTTGGTTAGGTTGGTTGGTTGAATTA-AAGCTTTGCAGAGAGGATCCTT	99	5'-CCGTAATACGACTCACTATAGGGGAGCTCGGTACCGAATTC-N35-AAGCTTTGCAGAGAGGATCCTT-3'	ssDNA	Mycobacterium Tuberculosis (H37Rv) (ATCC 93009)	PPK2 Enzyme	Identify aptamers that bind to and inhibit the catalytic activities of enzyme PPK2.	Inhibited PPK2 protein with an IC50 of 39.3 ± 10 nM and inhibited the NDK activities of both the LHK and VC PPK2 proteins with IC50 values of >1 μM and 105 ± 5 nM, respectively.	20	Isothermal Titration Calorimetry (ITC)	870 ± 220 nM	Therapeutics	SELEX	5'-Biotinylated	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0086	21627466	2011	Aptamer selection for the detection of Escherichia coli K88	Aptamer 19	CGTACGGTCGACGCTAGC-GGCGACCCCCGGGCTACCAGACAATGTACGCAGCAAGAGTGACGGTCGTACCTCGGAGTC-CACGTGGAGCTCGGATCC	96	5'-CGTACGGTCGACGCTAGC-N60-CACGTGGAGCTCGGATCC-3'	ssDNA	Escherichia Coli (E. Coli) ETEC K88 (CVCC 216)	K88 fimbriae protein	Identify aptamers that bind to and detect the K88 fimbriae protein of E.coli K88 surface protein.	N/A	11	Fluorescence Spectroscopy	44 ± 7 nM	Detection	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0087	21627466	2011	Aptamer selection for the detection of Escherichia coli K88	Aptamer 31	CGTACGGTCGACGCTAGC-ACACTCTTTTGCTCGTGTTTTTGCCTGTTACATAAAATGAATCAGTGGATGTTTCCTTCT-CACGTGGAGCTCGGATCC	96	5'-CGTACGGTCGACGCTAGC-N60-CACGTGGAGCTCGGATCC-3'	ssDNA	Escherichia Coli (E. Coli) ETEC K88 (CVCC 216)	K88 fimbriae protein	Identify aptamers that bind to and detect the K88 fimbriae protein of E.coli K88 surface protein.	N/A	11	Fluorescence Spectroscopy	36 ± 8 nM	Detection	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0088	21627466	2011	Aptamer selection for the detection of Escherichia coli K88	Aptamer 7	CGTACGGTCGACGCTAGC-GGCGGCCGTGAAATTTGCCAAATGCCGTCTTGGCTTTCGCCCAATGTATCCTGGGTGTTC-CACGTGGAGCTCGGATCC	96	5'-CGTACGGTCGACGCTAGC-N60-CACGTGGAGCTCGGATCC-3'	ssDNA	Escherichia Coli (E. Coli) ETEC K88 (CVCC 216)	K88 fimbriae protein	Identify aptamers that bind to and detect the K88 fimbriae protein of E.coli K88 surface protein.	N/A	11	Fluorescence Spectroscopy	43 ± 6 nM	Detection	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0089	21627466	2011	Aptamer selection for the detection of Escherichia coli K88	Aptamer 37	CGTACGGTCGACGCTAGC-GGAGACCGTACCATCTGTTCGTGGAAGCGCTTTGCTCGTCCATTAGCCTTGTGCTCGTGC-CACGTGGAGCTCGGATCC	96	5'-CGTACGGTCGACGCTAGC-N60-CACGTGGAGCTCGGATCC-3'	ssDNA	Escherichia Coli (E. Coli) ETEC K88 (CVCC 216)	K88 fimbriae protein	Identify aptamers that bind to and detect the K88 fimbriae protein of E.coli K88 surface protein.	Fluorescence intensity of other bacteria (ETEC K99, S. aureus, E. coli TOP10) is lower than that of ETEC K88.	11	Fluorescence Spectroscopy	25 ± 4 nM	Detection	SELEX	5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0090	22166202	2011	In vitro selection of Escherichia coli O157:H7-specific RNA aptamer	Two Arm ( from clone I-1)	GGGUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAUAGAUAGUAA	64	5'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3'	ssRNA	Escherichia Coli (E. Coli) O157:H7(ATCC 43895)	Whole cell	Identify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli.	Specifically bound to the lipopolysaccharide, which includes the O antigen from the O157:H7 strain, but not to the LPS from the K12 strain.	6	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	~110 nM	Detection	Subtractive SELEX	2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3'	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0091	22166202	2011	In vitro selection of Escherichia coli O157:H7-specific RNA aptamer	Clone I-1	GGGAUACCAGCUUAUUCAAUU-UGAUUCCAUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAU-AGAUAGUAAGUGCAAUCU	99	5'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3'	ssRNA	Escherichia Coli (E. Coli) O157:H7(ATCC 43895)	Whole cell	Identify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli.	Bound to the E. coli O157:H7 strain 2.8-fold better than the control.	6	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Subtractive SELEX	2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3'	N/A	N/A	N/A	N/A	N/A
ABdb_0092	22166202	2011	In vitro selection of Escherichia coli O157:H7-specific RNA aptamer	Clone III-2	GGGAUACCAGCUUAUUCAAUU-CGCACUGUUUUGCCCAGCCGUGUGAAAUUGAUUAGACGUUUUGUAUGCGAUUUCGCCUUG-AGAUAGUAAGUGCAAUCU	99	5'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3'	ssRNA	Escherichia Coli (E. Coli) O157:H7(ATCC 43895)	Whole cell	Identify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli.	Bound to the E. coli O157:H7 strain 2.3-fold better than the control.	6	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Subtractive SELEX	2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3'	N/A	N/A	N/A	N/A	N/A
ABdb_0093	21504182	2011	DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes	20A24P	AGCAGCACAGAGGTCAGATG-GGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGG-CCTATGCGTGCTACCGTGAA	80	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	Whole cell	Identify aptamers against the various M-types of S. pyogenes.	20A24P forms a branched structure with high affinity for the target cell mixture (gated fluorescence intensity above library of 64%).	20	Flow Cytometry	9.1 ± 0.8 nM	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0094	21504182	2011	DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes	15A3P	TTCACGGTAGCACGCATAGG-GACAGCAAGCCCAAGCTGGGTGTGCAAGGTGAGGAGTGGG-CATCTGACCTCTGTGCTGCT	80	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	Whole cell	Identify aptamers against the various M-types of S. pyogenes.	Show a gated fluorescence above the background of 48%.	20	Flow Cytometry	9.6 ± 0.3 nM	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0095	21504182	2011	DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes	20A1	CAGAACGCACCCGCACACCTCCATCACTCGCATGCACCCC	40	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	Whole cell	Identify aptamers against the various M-types of S. pyogenes.	72% gated fluorescence intensity above the library.	20	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0096	21504182	2011	DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes	20A1P	TTCACGGTAGCACGCATAGG-CAGAACGCACCCGCACACCTCCATCACTCGCATGCACCCC-CATCTGACCTCTGTGCTGCT	80	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	Whole cell	Identify aptamers against the various M-types of S. pyogenes.	72% gated fluorescence intensity above the library.	20	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0097	21504182	2011	DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes	20A8	CCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCC	40	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	Whole cell	Identify aptamers against the various M-types of S. pyogenes.	20A8 binding to the target GAS cells yielded 72% gated fluorescence above background.	20	Flow Cytometry	4 ± 1 nM	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0098	21504182	2011	DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes	20A8P	AGCAGCACAGAGGTCAGATG-CCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCC-CCTATGCGTGCTACCGTGAA	80	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	Whole cell	Identify aptamers against the various M-types of S. pyogenes.	20A8P binding to the target GAS cells yielded 68% gated fluorescence above background.	20	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0099	21504182	2011	DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes	20A9	CACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGG	39	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	Whole cell	Identify aptamers against the various M-types of S. pyogenes.	65% gated fluorescence intensity above the library.	20	Flow Cytometry	9 ± 1 nM	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0100	21504182	2011	DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes	20A9P	AGCAGCACAGAGGTCAGATG-CACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGG-CCTATGCGTGCTACCGTGAA	79	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	Whole cell	Identify aptamers against the various M-types of S. pyogenes.	66% gated fluorescence intensity above the library.	20	Flow Cytometry	9.1 ± 0.6 nM	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0101	21504182	2011	DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes	20A12P	TTCACGGTAGCACGCATAGG-GCCCGACACTCGTCCACCCGATACCTCTCATGTGTCCC-CATCTGACCTCTGTGCTGCT	78	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	Whole cell	Identify aptamers against the various M-types of S. pyogenes.	N/A	20	Flow Cytometry	25 ± 3 nM	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0102	21504182	2011	DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes	20A14P	AGCAGCACAGAGGTCAGATG-GGCATGGGGAAGAGAAAGCGGGATAACTTCGTTACCGGGC-CCTATGCGTGCTACCGTGAA	80	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	Whole cell	Identify aptamers against the various M-types of S. pyogenes.	N/A	20	Flow Cytometry	17 ± 1 nM	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0103	21743920	2011	Sensitive fluorescence assay of anthrax protective antigen with two new DNA aptamers and their binding properties	1–PA	GCGCGGATCCCGCGC-GATGTGGGTGTAGTTGGAGGGTAAACGTT-CGCGCGAAGCTTGCG	59	5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3'	ssDNA	Bacillus Anthracis (BA)	Protective antigen (PA) of anthrax toxin	Detection of PA based on the reduction in the fluorescence emission according to the formation of the aptamer-PA ternary complex.	The limit of PA detection using this system was determined to be approximately 1 nM.	8	Fluorescence Microplate Reader (Fluorescence Spectroscopy)	8.53 nM	Biosensor	SELEX	N/A	N/A	N/A	N/A	N/A	Korea Pat., KR101152354B1 (2012-06-13)
ABdb_0104	21743920	2011	Sensitive fluorescence assay of anthrax protective antigen with two new DNA aptamers and their binding properties	2–PA	GCGCGGATCCCGCGC-CAGACCGTAAGGGATGCCGCCTAAACACC-CGCGCGAAGCTTGCG	59	5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3'	ssDNA	Bacillus Anthracis (BA)	Protective antigen (PA) of anthrax toxin	Detection of PA based on the reduction in the fluorescence emission according to the formation of the aptamer-PA ternary complex.	The limit of PA detection using this system was determined to be approximately 1 nM.	8	Fluorescence Microplate Reader (Fluorescence Spectroscopy)	1.51 nM	Biosensor	SELEX	N/A	N/A	N/A	N/A	N/A	Korea Pat., KR101152354B1 (2012-06-13)
ABdb_0105	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F23	ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	F23 showed great specificity to P. aeruginosa and no cross-reactivity with other bacterial species.	15	Flow Cytometry	17.27 ± 5.00 nM	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0106	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F12	ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTTGCTTTTGTTCGCTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0107	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F8	ATACCAGCTTATTCAATT-CCGTGGCGTTCTGTTTGTTCGTTGTTTTTTGGTTTTTCCTTCTTTTTTTGTTTTTGGTTG-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0108	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F1	ATACCAGCTTATTCAATT-GGCGCGCGTTGTGTGGTTTGGCTTTTTTCGTTTGTTTTTCTTGGGTGCTTGTCTTCGTTG-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0109	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F20	ATACCAGCTTATTCAATT-CCCTCGCCGTACGTTCTCCGTTTTGTCAGGTGTTGTTTTTTCCGTCCTCTTCTCGTGTGC-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0110	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F4	ATACCAGCTTATTCAATT-CCACCGATTCCCTTCGATCGTATTCGTGTTGCTCTCGTGTTGTAATGCGTCCTGTGCTTG-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0111	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F6	ATACCAGCTTATTCAATT-GGCACCGGCTTGTCTGTTTCTCTTGGTTCGCCGCTGGACTTTGTTAGCTCCCTCCGCTTG-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0112	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F7	ATACCAGCTTATTCAATT-CCCCACAACCTGACCTTTCTATTCCGTTCCCCTTTTTTCAGCTTCTTTCCGGCCTCTGTT-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0113	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F18	ATACCAGCTTATTCAATT-CCACCACCGGGTTGTTTTTCCTGCAGGCCTTTATCGTTTTCCGCGCTCGATTCGGTCATG-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0114	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F5	ATACCAGCTTATTCAATT-CCACCGTGCTTTATATTACCCGTCCACCCTTCGGTCTTTCTCCCCGTGTCGCTCCGCTTT-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0115	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F21	ATACCAGCTTATTCAATT-CCACCGGGCCTCGTATTCGTACTGTTTGATTCTTTGGCTTTGTAGCGGACGTACTGGGTG-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0116	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F2	ATACCAGCTTATTCAATT-CCCCCGCGCCCGTCTCTCTCAATCTCCGCATTCTTTAGTTCTCATCCTCCCTGTGTGTTT-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0117	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F24	ATACCAGCTTATTCAATT-GACACCCGGAGTAATTCCGTTTTAAGCGTCTTTCATGTGTTCCCTTTCGTTCCTCCCTTG-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0118	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F15	ATACCAGCTTATTCAATT-CCCAAGGTCGAGTTCCTAGTCTTACCGTATTTCACTTTCCTGGTTCTTACCTCCCCCTCA-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0119	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F22	ATACCAGCTTATTCAATT-CGGCGCGAGTCGACTGCACAGGGTCCTATTGCTTATGGTCATGGTTTCGTTTCATCCTCG-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0120	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F16	ATACCAGCTTATTCAATT-CCCGCGATATGACCATCCAGCTGCTCCTCTGTTATTGTTGGTTTTCCTGTTTTCCTTTGT-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0121	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F17	ATACCAGCTTATTCAATT-CCCCAGTGCTCAGCTTCTCCTCCGTCTCATTCTTCTGTAGGATCGTTCTGTTTTGGTACT-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	57.63 ± 11.64 nM	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0122	20936492	2011	Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa	F10	ATACCAGCTTATTCAATT-CCCACCGTCCTCGTGCTTAGTCTTTATGTTTCGTCCTTTTCTTTCTTCGTTCTGTCGCCT-AGATAGTAAGTGCAATCT	96	5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa.	N/A	15	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0123	21875107	2011	Identification of environmental reservoirs of nontyphoidal salmonellosis: aptamer-assisted bioconcentration and subsequent detection of salmonella typhimurium by quantitative polymerase chain reaction	Sal aptamer	CTCACCAGGAGATTACAACATGG-TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG-AGCTCAGACCAAAAGTGACCATC	86	5'-CTCACCAGGAGATTACAACATGG-N40-AGCTCAGACCAAAAGTGACCATC-3'	ssDNA	Salmonella Typhimurium (S. Typhimurium)	Whole cell	Detection of Salmonella Typhimurium by serovar-specific DNA aptamer-conjugated dynabeads in water samples.	Sediments from the selected sampling locations also exhibit Salmonella Typhimurium in the range of 3.37 × 10(4) to 3.08 × 10(9) cfu/100 g.	N/A	N/A	N/A	Detection	N/A	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A