Year : 2010

Total records found: 11

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0075	20452328	2010	In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin	S132B-C11	GGGAGGAGGAGAGAUGUGAACUU-AUUCGGGCCCAGGAACCAACUAUAUAAAUGUCCCGAAUGCUUCGACG-AGAAACUCUACACUGGACUGGCG	93	5'-GGGAGGAGGAGAGATGTGAACTT-N47-AGAAACTCTACACTGGACTGGCG-3'	ssRNA	Clostridium Botulinum	Botulinum neurotoxins (BoNT)-light chain of type A (BoNT/A)	Identify aptamers against the light chain of type A BoNT (BoNT/A) and inhibit the endopeptidase activity.	IC50 values of 304 ± 13 nM and KI' of 163 nM for C11.	9	Nitrocellulose Filter Retention Assay	186 ± 18 nM	Therapeutics	SELEX	2'-Fluoro pyrimidines (2'-F-RNA) and Radiolabelled ([α-33P]-GTP labeled)	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0076	20452328	2010	In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin	S132B-C12	GGGAGGAGGAGAGAUGUGAACUU-ACAACCCGGAACAACGUCUAACAGUGUACCAUAACCCGGCAUUCA-AGAAACUCUACACUGGACUGGCG	91	5'-GGGAGGAGGAGAGATGTGAACTT-N47-AGAAACTCTACACTGGACTGGCG-3'	ssRNA	Clostridium Botulinum	Botulinum neurotoxins (BoNT)-light chain of type A (BoNT/A)	Identify aptamers against the light chain of type A BoNT (BoNT/A) and inhibit the endopeptidase activity.	IC50 values of 66 ± 2 nM and KI' of 525 nM for C12.	9	Nitrocellulose Filter Retention Assay	111 ± 12 nM	Therapeutics	SELEX	2'-Fluoro pyrimidines (2'-F-RNA) and Radiolabelled ([α-33P]-GTP labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_0077	20452328	2010	In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin	S132B-C22	GGGAGGAGGAGAGAUGUGAACUU-GACAGCGUGCCUAGAAGUCCAAGCUUAAAUAACCACGCUCGACAAGC-AGAAACUCUACACUGGACUGGCG	93	5'-GGGAGGAGGAGAGATGTGAACTT-N47-AGAAACTCTACACTGGACTGGCG-3'	ssRNA	Clostridium Botulinum	Botulinum neurotoxins (BoNT)-light chain of type A (BoNT/A)	Identify aptamers against the light chain of type A BoNT (BoNT/A) and inhibit the endopeptidase activity.	IC50 values of 214 ± 9 nM and KI' of 603 nM for C22.	9	Nitrocellulose Filter Retention Assay	87 ± 20 nM	Therapeutics	SELEX	2'-Fluoro pyrimidines (2'-F-RNA) and Radiolabelled ([α-33P]-GTP labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_0078	20337767	2010	Antibody-aptamer functionalized fibre-optic biosensor for specific detection of Listeria monocytogenes from food	A8	ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT	47	N/A	ssDNA	Listeria Monocytogenes (F4244)	Internalin A (InlA)	Antibody-aptamer functionalized fibre‐optic biosensor for specific detection of Listeria monocytogenes from food products.	The detection limit of this sensor was 1 × 10(3) CFU/ml, and it could successfully detect a lower inoculum size of 10(2) CFU/25g.	N/A	N/A	N/A	Biosensor	N/A	AlexaFluor 647 Labeled or Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0079	20961052	2010	Real-time potentiometric detection of bacteria in complex samples	Aptamer	GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU	81	N/A	ssRNA	Escherichia Coli (E. Coli) CECT 675 cells	Whole cell	Potentiometric aptamer-based biosensor to detect E. coli CECT 675 as a nonpathogenic surrogate for pathogenic E. coli O157:H7 in complex liquid samples.	Display LOD of 10(4) CFU/mL with a linear range from 4 to ∼10(4) CFU/mL. The lowest bacterial count detected in complex matrices was 12 CFU in 2 mL of milk (6 CFU/mL) and 26 CFU in 1 mL of apple juice.	N/A	N/A	N/A	Biosensor	N/A	3'-Amidation ((CH2)5-NH₂)	N/A	N/A	N/A	N/A	N/A
ABdb_0080	20443050	2010	A novel screening method for competitive FRET-aptamers applied to E. coli assay development	EcO 4R	ATCCGTCACACCTGCTCT-ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA-TGGTGTTGGCTCCCGTAT	73	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) strain 8739 (Crooks strain)	Outer membrane protein (OMP)	Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins.	Detect as few as 30 live, unlabeled E. coli per ml using FRET assay.	5	Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA)	N/A	Biosensor	Magnetic Bead (MB)-based SELEX	5'-Biotinylated and AlexaFluor 647 Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0081	20443050	2010	A novel screening method for competitive FRET-aptamers applied to E. coli assay development	EcO 3R	ATCCGTCACACCTGCTCT-GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG-TGGTGTTGGCTCCCGTAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) strain 8739 (Crooks strain)	Outer membrane protein (OMP)	Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins.	N/A	5	Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA)	N/A	Biosensor	Magnetic Bead (MB)-based SELEX	5'-Biotinylated and AlexaFluor 647 Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0082	20443050	2010	A novel screening method for competitive FRET-aptamers applied to E. coli assay development	EcO 8F	ATACGGGAGCCAACACCA-CGACTAACACGACCGTTGGGGGGGGCTCGCGCGGGC-AGAGCAGGTGTGACGGAT	72	5'-ATACGGGAGCCAACACCA-N36-AGAGCAGGTGTGACGGAT-3'	ssDNA	Escherichia Coli (E. Coli) strain 8739 (Crooks strain)	Outer membrane protein (OMP)	Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins.	N/A	5	Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA)	N/A	Biosensor	Magnetic Bead (MB)-based SELEX	5'-Biotinylated and AlexaFluor 647 Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0083	https://doi.org/10.4028/www.scientific.net/KEM.439-440.1456	2010	In Vitro Selection of Oligonucleotide Acid Aptamers against Pathogenic Vibrio Alginolyticus by SELEX	Sequence A	GCCCAATCGCCGTCTTCTACA-TGTGCGTGTGTCAGCGAATATCACCTAGAGGTCGG-AGTGCCAACGCCCTCCTGAT	76	5'-GCCCAATCGCCGTCTTCTACA-N35-AGTGCCAACGCCCTCCTGAT-3'	ssDNA	Vibrio Alginolyticus	Whole cell	Identify a high-affinity aptamer against Vibrio alginolyticus.	Bind to different sites of the V. alginolyticus surface.	15	N/A	N/A	Detection	SELEX	5'-DIG (Digoxigenin) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0084	https://doi.org/10.4028/www.scientific.net/KEM.439-440.1456	2010	In Vitro Selection of Oligonucleotide Acid Aptamers against Pathogenic Vibrio Alginolyticus by SELEX	Sequence B	CCCAATCGCCGTCTTCTACA-TGTATGCTGCCGAGGTTGGCCTCTTAGTCAGCTGAGAGTGCCAACGCCCTCCTGATATGCCCAATCGCCGTCTTCTACATTGTGGTCGTGGGAATGCATTCATCCGTTGCCGG-AGTGCCAACGCCCTCC	149	5'-GCCCAATCGCCGTCTTCTACA-N35-AGTGCCAACGCCCTCCTGAT-3'	ssDNA	Vibrio Alginolyticus	Whole cell	Identify a high-affinity aptamer against Vibrio alginolyticus.	Bind to different sites of the V. alginolyticus surface.	15	N/A	N/A	Detection	SELEX	5'-DIG (Digoxigenin) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1958	20582587	2010	Selection and characterization of DNA aptamers with binding selectivity to Campylobacter jejuni using whole-cell SELEX	ONS-23	N/A	N/A	5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3'	ssDNA	Campylobacter Jejuni (A9a)	Whole cell (bind via proteinaceous nature for cell surface target)	Identify aptamers against C. jejuni and detect them in a mixed cell population.	ONS-23 showed high binding affinity (25–36%) for all other C. jejuni strains screened (inclusivity) and low apparent binding affinity (1–5%) with non-C. jejuni strains (exclusivity).	10	Flow Cytometry	292.8 ± 53.1 nM	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	WO Patent WO/2011/097420