Year : 2009

Total records found: 27

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0049	19498077	2009	Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus	SA20	GCAATGGTACGGTACTTCC-GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT-CAAAAGTGCACGCTACTTTGCTAA	88	5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'	ssDNA	Staphylococcus aureus (S. aureus)	Whole cell	Identify aptamers that bind to S. aureus strains, including 8325-4, 196, and 04018, and develop a probe to distinguish them from S. epidermidis, Streptococcus, and E. coli.	EC50 = 70.86 ± 39.22nM and with Multiple aptamers: 479.98 ± 209.94nM.	5	Flow Cytometry	N/A	Detection	Subtractive SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0050	19498077	2009	Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus	SA23	GCAATGGTACGGTACTTCC-GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA-CAAAAGTGCACGCTACTTTGCTAA	88	5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'	ssDNA	Staphylococcus aureus (S. aureus)	Whole cell	Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli.	EC50 = 61.50 ± 22.43nM and with Multiple aptamers: 479.98 ± 209.94nM.	5	Flow Cytometry	N/A	Detection	Subtractive SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0051	19498077	2009	Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus	SA31	GCAATGGTACGGTACTTCC-TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA-CAAAAGTGCACGCTACTTTGCTAA	88	5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'	ssDNA	Staphylococcus aureus (S. aureus)	Whole cell	Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli.	EC50=82.86 ± 33.20nM and with Multiple aptamers: 479.98 ± 209.94nM.	5	Flow Cytometry	N/A	Detection	Subtractive SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0052	19498077	2009	Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus	SA34	GCAATGGTACGGTACTTCC-CACAGTCACTCAGACGGCCGCTATTGTTGCCAGATTGCCTTTGGC-CAAAAGTGCACGCTACTTTGCTAA	88	5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'	ssDNA	Staphylococcus aureus (S. aureus)	Whole cell	Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli.	EC50 =72.42 ± 35.23nM and with Multiple aptamers: 479.98 ± 209.94nM.	5	Flow Cytometry	N/A	Detection	Subtractive SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0053	19498077	2009	Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus	SA43	GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA	88	5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'	ssDNA	Staphylococcus aureus (S. aureus)	Whole cell	Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli.	EC50 = 210.70 ± 135.91nM and with Multiple aptamers: 479.98 ± 209.94nM.	5	Flow Cytometry	N/A	Detection	Subtractive SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0054	18671260	2009	Preliminary development of DNA aptamer-Fc conjugate opsonins	α-PDGA 2F	CATCCGTCACACCTGCTCTG-GTTCGCCCCGGTCAAGGAGA-GTGGTGTTGGCTCCCGTATC	60	5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3'	ssDNA	Bacillus Anthracis (BA)	Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule	Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins.	Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Amidation (NH₂) and 5'-Biotinylated	Cell viability ranged from 90% to 95% in all experiments.	N/A	Best Candidate	N/A	N/A
ABdb_0055	18671260	2009	Preliminary development of DNA aptamer-Fc conjugate opsonins	α-PDGA 5R	GATACGGGAGCCAACACCAC-TAACTTGTTGCTGATCTTAT-CAGAGCAGGTGTGACGGATG	60	5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3'	ssDNA	Bacillus Anthracis (BA)	Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule	Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins.	Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Amidation (NH₂) and 5'-Biotinylated	Cell viability ranged from 90% to 95% in all experiments.	N/A	Best Candidate	N/A	N/A
ABdb_0056	18671260	2009	Preliminary development of DNA aptamer-Fc conjugate opsonins	α-PDGA 2R	GATACGGGAGCCAACACCAC-TCTCCTTGACCGGGGCGAAC-CAGAGCAGGTGTGACGGATG	60	5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3'	ssDNA	Bacillus Anthracis (BA)	Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule	Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins.	N/A	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Amidation (NH₂) and 5'-Biotinylated	Cell viability ranged from 90% to 95% in all experiments.	N/A	N/A	N/A	N/A
ABdb_0057	18671260	2009	Preliminary development of DNA aptamer-Fc conjugate opsonins	α-PDGA 5F	CATCCGTCACACCTGCTCTG-GATAAGATCAGCAACAAGTTA-GTGGTGTTGGCTCCCGTATC	61	5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3'	ssDNA	Bacillus Anthracis (BA)	Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule	Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins.	N/A	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Amidation (NH₂) and 5'-Biotinylated	Cell viability ranged from 90% to 95% in all experiments.	N/A	N/A	N/A	N/A
ABdb_0058	19751419	2009	Antibiotic resistance in bacteria: novel metalloenzyme inhibitors	Metallo-β-lactamase-targeting aptamers	CGCGAGCTCCGCGCG-AACCAAACTTGGATCGGTGCACATGTCGAA-CGCGCGCATATGGCGC	61	5'-CGCGAGCTCCGCGCG-N30-CGCGCGCATATGGCGC-3'	ssDNA	Bacillus Cereus 5/B/6 and Escherichia Coli (E. Coli) TAP56	Metallo-β-lactamase active sites	Identify aptamers that bind and inhibit the hydrolytic enzyme activity by interfering with the active-site metal ions of the β-lactamase enzyme.	LC50 values in the presence of 5 μM cephalexin: 75 μM and 32 μM for B. cereus 5/B/6 and E. coli TAP56, respectively.	21	Metallo-β-lactamase activity assays	Ki = 0.92 nM	Therapeutics	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_0059	19265672	2009	A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia	Aptamer 19	TAGGGAATTCGTCACGGATCC-GGCGTCCACTCCCAGCCGCTCACTAGTTTCTGCGTGGGTGA-CTGCAGGTCGACGCATGCGCCG	84	5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3'	ssDNA	Gram-negative Bacteria	Endotoxin (Lipopolysaccharide (LPS))	Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes.	Survival rate of mice with LPS-induced sepsis increased from 10% to 75% after treatment.	12	Nitrocellulose Filter Binding Assay	N/A	Diagnostic/Therapeutics	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled)	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0060	19265672	2009	A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia	Aptamer 18	TAGGGAATTCGTCACGGATCC-GGCGTCCACTCCCAGCCGGTCACTAGTTTCTGCGTGGGTGA-CTGCAGGTCGACGCATGCGCCG	84	5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3'	ssDNA	Gram-negative Bacteria	Endotoxin (Lipopolysaccharide (LPS))	Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes.	N/A	12	Nitrocellulose Filter Binding Assay	N/A	Diagnostic/Therapeutics	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_0061	19265672	2009	A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia	Aptamer 31	TAGGGAATTCGTCACGGATCC-GGAGAATAACGACAAAAGGTAAACTACAGGCCCGGAGC-CTGCAGGTCGACGCATGCGCCG	81	5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3'	ssDNA	Gram-negative Bacteria	Endotoxin (Lipopolysaccharide (LPS))	Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes.	N/A	12	Nitrocellulose Filter Binding Assay	N/A	Diagnostic/Therapeutics	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_0062	19265672	2009	A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia	Aptamer 14	TAGGGAATTCGTCACGGATCC-AAAAGTCCTTGCAAGATAGACGCAGCCAGCCGGGTAGTC-CTGCAGGTCGACGCATGCGCCG	82	5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3'	ssDNA	Gram-negative Bacteria	Endotoxin (Lipopolysaccharide (LPS))	Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes.	N/A	12	Nitrocellulose Filter Binding Assay	N/A	Diagnostic/Therapeutics	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_0063	19265672	2009	A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia	Aptamer 25	TAGGGAATTCGTCACGGATCC-CTTGGCGTTACTTACCTGTACGTCGTAGAG-CTGCAGGTCGACGCATGCGCCG	73	5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3'	ssDNA	Gram-negative Bacteria	Endotoxin (Lipopolysaccharide (LPS))	Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes.	N/A	12	Nitrocellulose Filter Binding Assay	N/A	Diagnostic/Therapeutics	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_0064	19265672	2009	A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia	Aptamer 43	TAGGGAATTCGTCACGGATCC-TGAACGACGTCGCATTAGCGAGTAGGTTTACGAAGTAAGA-CTGCAGGTCGACGCATGCGCCG	83	5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3'	ssDNA	Gram-negative Bacteria	Endotoxin (Lipopolysaccharide (LPS))	Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes.	N/A	12	Nitrocellulose Filter Binding Assay	N/A	Diagnostic/Therapeutics	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_0065	19284297	2009	The selection and application of ssDNA aptamers against MPT64 protein in Mycobacterium tuberculosis	M64CA (aptamers 20, 34, 41, 46, and 50 )	GGGAGCTCAGAATAAACGCTCAA-TTCGGGAATGATTATCAAATTTATGCCCTCTGAT-TTCGACATGAGGCCCGGATC	77	5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'	ssDNA	Mycobacterium Tuberculosis (M.Tb.)	MPT64 protein	Identify an aptamer that binds to MPT64, and an aptamer-MPT64 was designed to detect M. tuberculosis by measuring MPT64 protein levels in culture filtrates.	The sandwich assay scheme based on the aptamer-protein complex had a high sensitivity (86.3%) and specificity (88.5%).	12	N/A	N/A	Detection	SELEX	Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0066	19284297	2009	The selection and application of ssDNA aptamers against MPT64 protein in Mycobacterium tuberculosis	Aptamer 11 (named M64RA)	GGGAGCTCAGAATAAACGCTCAA-TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA-TTCGACATGAGGCCCGGATC	78	5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'	ssDNA	Mycobacterium Tuberculosis (M.Tb.)	MPT64 protein	Identify an aptamer that binds to MPT64, and an aptamer-MPT64 was designed to detect M. tuberculosis by measuring MPT64 protein levels in culture filtrates.	The sandwich assay scheme based on the aptamer-protein complex had a high sensitivity (86.3%) and specificity (88.5%).	12	N/A	N/A	Detection	SELEX	Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0067	19049862	2009	Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars	Aptamer 33	TTTGGTCCTTGTCTTATGTCCAGAATGC-TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG-ATTTCTCCTACTGGGATAGGTGGATTAT	96	5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3'	ssDNA	Salmonella Typhimurium (S. Typhimurium) DT104	Outer membrane protein (OMP)	Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium.	In a pull-down assay format, detection limits were 10¹–10² CFU S. Typhimurium/9 mL rinsate, while in a recirculation format, detection limits were 10²–10³ CFU/25 mL rinsate.	7	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Biosensor	SELEX	5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0068	19049862	2009	Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars	Aptamer 23	TTTGGTCCTTGTCTTATGTCCAGAATGC-CCGCCTTTACTAAATTGACGAACATAGGAATCAATGAAGC-ATTTCTCCTACTGGGATAGGTGGATTAT	96	5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3'	ssDNA	Salmonella Typhimurium (S. Typhimurium) DT104	Outer membrane protein (OMP)	Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium.	N/A	7	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Biosensor	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0069	19049862	2009	Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars	Aptamer 24	TTTGGTCCTTGTCTTATGTCCAGAATGC-GGGAGTCAGAACGCCTGGGCAAGCATAGTACTCGCCGGAA-ATTTCTCCTACTGGGATAGGTGGATTAT	96	5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3'	ssDNA	Salmonella Typhimurium (S. Typhimurium) DT104	Outer membrane protein (OMP)	Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium.	N/A	7	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Biosensor	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0070	19049862	2009	Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars	Aptamer 25	TTTGGTCCTTGTCTTATGTCCAGAATGC-TAAAGAGGAATCGACAGGCATCAGAGTCCGTAATGCGGGG-ATTTCTCCTACTGGGATAGGTGGATTAT	96	5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3'	ssDNA	Salmonella Typhimurium (S. Typhimurium) DT104	Outer membrane protein (OMP)	Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium.	N/A	7	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Biosensor	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0071	19049862	2009	Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars	Aptamer 45	TTTGGTCCTTGTCTTATGTCCAGAATGC-GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA-ATTTCTCCTACTGGGATAGGTGGATTAT	96	5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3'	ssDNA	Salmonella Typhimurium (S. Typhimurium) DT104	Outer membrane protein (OMP)	Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium.	N/A	7	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Biosensor	SELEX	5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0072	19569156	2009	Immediate detection of living bacteria at ultralow concentrations using a carbon nanotube based potentiometric aptasensor	Aptamer	GGGAACAGUCCGAGCCUCACUGUUAUCCGAUAGCAGCGCGGGAUGAGGGUCAAUGCGUCAUAGGAUCCCGC	71	N/A	ssRNA	Salmonella Typhi (CECT 409)	Type IVB Pili structural proteins	Develop a potentiometric biosensor using an aptamer-SWCNT for selectively detecting a single CFU of ST in close to real time.	Display detection range from 0.2 CFU/mL (1 CFU in 5 mL PBS) to 10(6) CFU/mL within 60sec.	N/A	N/A	N/A	Biosensor	N/A	3'-Amidation ((CH2)5-NH₂)	N/A	N/A	N/A	N/A	N/A
ABdb_0073	19505816	2009	A sensitive method to detect Escherichia coli based on immunomagnetic separation and real-time PCR amplification of aptamers	E. coli specific RNA aptamer	GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU	81	N/A	ssRNA	Escherichia Coli (E. Coli) DH5α	Whole cell	Develop an aptamer-based, antibody-conjugated magnetic-bead sandwich assay to detect E. coli.	Showed a wide dynamic range from 10¹ to 10(7) E. coli per ml and achieved a detection limit of 10 E. coli in a 1 ml sample.	N/A	N/A	N/A	Biosensor	N/A	2'-Fluoro pyrimidines (2'-F-RNA)	N/A	N/A	N/A	N/A	N/A
ABdb_0074	19234874	2009	Aptamer-based electrochemical biosensor for Botulinum neurotoxin	BoNT/A aptamer	ATACCAGCTTATTCAATTGACATGACTGGGATTTTTGGCGAAATCGAAGGAAGCGGAGAGATAGTAAGTGCAATCT	76	N/A	ssDNA	Clostridium Botulinum	Botulinum neurotoxins (BoNT)-light chain of type A (BoNT/A) toxoid	Developed an aptamer-based electrochemical sensor for the detection of Botulinum neurotoxin.	Achieved a limit of detection (LOD) of 40 pg/ml within 24 h.	N/A	N/A	3.0 ± 0.8 × 10(9) M−1	Biosensor	Single micro-bead SELEX	5'-Biotinylated and 3'-Fluorescein Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1957	19052851	2009	Plastic-adherent DNA aptamer-magnetic bead and quantum dot sandwich assay for Campylobacter detection	C2 and C3	N/A	N/A	N/A	ssDNA	Campylobacter Jejuni (ATCC 29428)	Surface protein	Identify aptamers against surface proteins from C. jejuni and develop a sandwich assay ( (C2 aptamer-MB-bacteria-C3 aptamer-QD complexes) for its detection.	Exhibits detection limits as low as an average of 2.5 cfu equivalents in buffer and 10–250 cfu in various food matrices.	5	N/A	N/A	Biosensor	SELEX	5'-Amidation (NH₂)	N/A	N/A	N/A	N/A	N/A