Year : 2008

Total records found: 23

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0026	18759112	2008	In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes	L1F	ATCCGTCACCCCTGCTCTCGTCGCTATGAAGTAACAAAGATAGGAGCAATCGGGTGGTGTTGGCTCCCGTAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) O111:B4 and K12 strains	Lipopolysaccharide (LPS) and Whole cell	Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.	Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0027	18759112	2008	In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes	L3F	ATCCGTCACACCTGCTCTAACGAAGACTGAAACCAAAGCAGTGACAGTGCTGAATGGTGTTGGCTCCCGTAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) O111:B4 and K12 strains	Lipopolysaccharide (LPS) and Whole cell	Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.	Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0028	18759112	2008	In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes	L4F	ATCCGTCACACCTGCTCTCGGTGACAATAGCTCGATCAGCCCAAAGTCGTCAGATGGTGTTGGCTCCCGTAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) O111:B4 and K12 strains	Lipopolysaccharide (LPS) and Whole cell	Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.	Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0029	18759112	2008	In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes	L6F	ATCCGTCACACCTGCTCTAACGAAATAGACCACAAATCGATACTTTATGTTATTGGTGTTGGCTCCCGTAT	71	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) O111:B4 and K12 strains	Lipopolysaccharide (LPS) and Whole cell	Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.	Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0030	18759112	2008	In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes	L7F	ATCCGTCACACCTGCTCTGTCGAATGCTCTGCCTGGAAGAGTTGTTAGCAGGGATGGTGTTGGCTCCCGTAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) O111:B4 and K12 strains	Lipopolysaccharide (LPS) and Whole cell	Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.	Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0031	18759112	2008	In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes	L8F	ATCCGTCACACCTGCTCTTAAGCCGAGGGGTAAATCTAGGACAGGGGTCCATGATGGTGTTGGCTCCCGTAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) O111:B4 and K12 strains	Lipopolysaccharide (LPS) and Whole cell	Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.	Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0032	18759112	2008	In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes	L9F	ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) O111:B4 and K12 strains	Lipopolysaccharide (LPS) and Whole cell	Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.	Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0033	18759112	2008	In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes	L10F	ATCCGTCACACCTGCTCTGGTACGAATCACAGGGGATGCTGGAAGCTTGGCTCTTGGTGTTGGCTCCCGTAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) O111:B4 and K12 strains	Lipopolysaccharide (LPS) and Whole cell	Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.	Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0034	18759112	2008	In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes	L1R	ATACGGGAGCCAACACCACCCGATTGCTCCTATCTTTGTTACTTCATAGCGACGAGAGCAGGGGTGACGGAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) O111:B4 and K12 strains	Lipopolysaccharide (LPS) and Whole cell	Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.	Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0035	18759112	2008	In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes	L3R	ATACGGGAGCCAACACCATTCAGCACTGTCACTGCTTTGGTTTCAGTCTTCGTTAGAGCAGGTGTGACGGAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) O111:B4 and K12 strains	Lipopolysaccharide (LPS) and Whole cell	Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.	Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0036	18759112	2008	In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes	L4R	ATACGGGAGCCAACACCATCTGACGACTTTGGGCTGATCGAGCTATTGTCACCGAGAGCAGGTGTGACGGAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) O111:B4 and K12 strains	Lipopolysaccharide (LPS) and Whole cell	Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.	Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0037	18759112	2008	In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes	L6R	ATACGGGAGCCAACACCAATAACATAAAGTATCGATTTGTGGTCTATTTCGTTAGAGCAGGTGTGACGGAT	71	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) O111:B4 and K12 strains	Lipopolysaccharide (LPS) and Whole cell	Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.	Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0038	18759112	2008	In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes	L7R	ATACGGGAGCCAACACCATCCCTGCTAACAACTCTTCCAGGCAGAGCATTCGACAGAGCAGGTGTGACGGAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) O111:B4 and K12 strains	Lipopolysaccharide (LPS) and Whole cell	Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.	Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0039	18759112	2008	In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes	L8R	ATACGGGAGCCAACACCATCATGGACCCCTGTCCTAGATTTACCCCTCGGCTTAAGAGCAGGTGTGACGGAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) O111:B4 and K12 strains	Lipopolysaccharide (LPS) and Whole cell	Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.	Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0040	18759112	2008	In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes	L9R	ATACGGGAGCCAACACCACATAACTTCCTTCTTAGTCATGCTGAGCCGGCCAGTAGAGCAGGTGTGACGGAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) O111:B4 and K12 strains	Lipopolysaccharide (LPS) and Whole cell	Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.	Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0041	18759112	2008	In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes	L10R	ATACGGGAGCCAACACCAAGAGCCAAGCTTCCAGCATCCCCTGTGATTCGTACCAGAGCAGGTGTGACGGAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Escherichia Coli (E. Coli) O111:B4 and K12 strains	Lipopolysaccharide (LPS) and Whole cell	Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.	Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.	5	Colorimetric Peroxidase-Based Aptamer Plate Binding Assay	N/A	Therapeutics	Magnetic Bead (MB)-based SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0042	18803393	2008	Selection of aptamers against live bacterial cells	hemag1P	AGCAGCACAGAGGTCAGATG-TAGCCCTTCAACATAGTAATATCTCTGCATTCTGTGTG-CCTATGCGTGCTACCGTGAA	78	5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Lactobacillum Acidophilius (ATCC 4356)	Surface protein (S-layer protein)	Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae).	The number of aptamer molecules binding to each cell (on average, ∼164 ± 47 aptamer molecules per cell).	8	Flow Cytometry	13 ± 3 nM	Detection	SELEX	5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0043	18803393	2008	Selection of aptamers against live bacterial cells	hemag1	TAGCCCTTCAACATAGTAATATCTCTGCATTCTGTGATG	39	5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Lactobacillum Acidophilius (ATCC 4356)	Surface protein (S-layer protein)	Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae).	N/A	8	Flow Cytometry	N/A	Detection	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0044	18803393	2008	Selection of aptamers against live bacterial cells	mag1	TGAGCCCCACTAAAGTTGCAATCATGTCGTCAGCTTTGGG	40	5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Lactobacillum Acidophilius (ATCC 4356)	Surface protein (S-layer protein)	Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae).	N/A	8	Flow Cytometry	N/A	Detection	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0045	18803393	2008	Selection of aptamers against live bacterial cells	hemag3	CGTCGCGGCATATTTCCAGTGGAACGGTTACGATATGTTG	40	5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Lactobacillum Acidophilius (ATCC 4356)	Surface protein (S-layer protein)	Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae).	N/A	8	Flow Cytometry	N/A	Detection	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0046	18803393	2008	Selection of aptamers against live bacterial cells	mag1P	AGCAGCACAGAGGTCAGATG-TGAGCCCCAGTAAAGTTGCAATCATGTCGTCAGCTTTGGG-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Lactobacillum Acidophilius (ATCC 4356)	Surface protein (S-layer protein)	Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae).	N/A	8	Flow Cytometry	N/A	Detection	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0047	18803393	2008	Selection of aptamers against live bacterial cells	hemag3P	AGCAGCACAGAGGTCAGATG-TCGTCGCGGCATATTTCCAGTGGAACGGTTACGATATGTTG-CCTATGCGTGCTACCGTGAA	81	5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Lactobacillum Acidophilius (ATCC 4356)	Surface protein (S-layer protein)	Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae).	N/A	8	Flow Cytometry	N/A	Detection	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0048	18214875	2008	Detection and titer estimation of Escherichia coli using aptamer-functionalized single-walled carbon-nanotube field-effect transistors	Aptamer	GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU	81	N/A	ssRNA	Escherichia Coli (E. Coli) DH5α	Whole cell	Develop aptamer-functionalized SWNT-FET sensors for the detection of E. coli.	The SWNT-FETs showed a conductance decrease of more than 50% after binding with E. coli in less than 20 min.	N/A	N/A	N/A	Detection	SELEX	3'-Biotinylated	N/A	N/A	N/A	N/A	N/A