Year : 2007

Total records found: 4

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0024	17188871	2007	In vitro selection of RNA aptamer against Escherichia coli release factor 1	Class II-1	GGACCGAGAAGUUACCCUGUAAUCUUAGGAUGAAUCGCAUGCUCUAGCGACCUUUUCGGCUUCGGCGUACGCACAUCGCAGCAAC	85	N/A	ssRNA	Escherichia Coli (E. Coli)	Release factor 1 (RF-1)	Identify aptamers that bind to and inhibit the action of RF-1 to enhance the efficiency of nonsense suppression.	Aptamer class II-1 (12 μM) increased the suppression efficiency (44% → 89%).	11	Surface Plasmon Resonance (SPR)	30 ± 6 nM	Therapeutics	SELEX	3'-Biotinylated (Biotin-d(A)11) or 3'-TexasRed Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0025	17265180	2007	Fluorescence assay based on aptamer-quantum dot binding to Bacillus thuringiensis spores	Aptamer	CATCCGTCACACCTGCTCTGGCCACTAACATGGGGACCAGGTGGTGTTGGCTCCCGTATC	60	N/A	ssDNA	Bacillus Thuringiensis (BT)	BT spores	Aptamer coupled to fluorescent zinc sulfide-capped, cadmium selenide quantum dots (QD) for detecting BT spores.	Limit of detection (LOD) between 10³ and 10(4) CFU.	N/A	N/A	N/A	Biosensor	SELEX	5'-Thiolated (HS-(CH2)6)	N/A	N/A	N/A	N/A	N/A
ABdb_1955	17442275	2007	Aptamer from whole-bacterium SELEX as new therapeutic reagent against virulent Mycobacterium tuberculosis	NK2	N/A	N/A	5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3'	ssDNA	Mycobacterium Tuberculosis (H37Rv) (ATCC 93009)	Membrane protein	Identify an aptamer that binds to and improves CD4+T cells & produces IFN-γ by blocking some membrane proteins of H37Rv, decreases the bacterial number, and prolongs the survival rate in the mouse model by inhibiting the invasion of M. tuberculosis into phagocytes and CD8+T cells.	Intracellular IFN-γ levels in CD3+CD4+ T cells increased from approximately 35% (without aptamer) to approximately 55% (with the NK2). The half-life of survival in mice was prolonged by 3 days with a single injection of NK2 aptamer treatment.	10	Isothermal Titration Calorimetry (ITC)	N/A	Therapeutics	Whole Cell-SELEX	FITC Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1956	17344350	2007	Development and characterization of monoclonal antibodies and aptamers against major antigens of Mycobacterium avium subsp. paratuberculosis	Aptamer 94	N/A	N/A	5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3'	ssDNA	Mycobacterium Avium subsp. paratuberculosis (ATCC 19698)	MAP0105c gene product	Identify aptamers that were screened against the MAP0105c gene product.	Bound specifically to the N-terminal half of MAP0105c, and nearly all mycobacteria tested.	12	N/A	N/A	Detection	Counter-SELEX	N/A	N/A	N/A	N/A	N/A	N/A