Year : 2004

Total records found: 6

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0009	15023071	2004	In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA	F1-1	GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-ACUGUCCUCCCUUCAGAGAGCGCGGGACCCUUAACUUGGGGCCCACGAACAGCUUCAGUUCCGUCUCGGCGU-CAUAUGUGCGUCUACAUGGAUCCUCA	140	5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3'	ssRNA	Escherichia Coli (E. Coli)	C-terminal ribonuclease domain of Colicin E3	Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity.	Addition of aptamer F1-1 in a 1000-fold excess over the colicin E3 CRD completely restored protein synthesis.	12	Nitrocellulose Filter Binding Assay	2 ± 11 nM	Therapeutics	SELEX	5'-Radiolabelled (32P-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_0010	15023071	2004	In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA	F2-1	GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-UCCCUGGCCCAAGAUCCUAAUAAAGUUUUUUCGGACCGGAGCGAAACCACUAUCCUCUUAAGCAAUCUGU-CAUAUGUGCGUCUACAUGGAUCCUCA	138	5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3'	ssRNA	Escherichia Coli (E. Coli)	C-terminal ribonuclease domain of Colicin E3	Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity.	Addition of aptamer F2-1 in a 1000-fold excess over the colicin E3 CRD completely restored protein synthesis.	12	Nitrocellulose Filter Binding Assay	14 ± 2 nM	Therapeutics	SELEX	5'-Radiolabelled (32P-labeled)	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0011	15023071	2004	In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA	F3-1	GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GUACAACACAUCAUUACGGCUGCUAUUGGCUCCAAGCGUCUUUCUCCCUGGUCAAUAGUCCAGCCACCACG-CAUAUGUGCGUCUACAUGGAUCCUCA	139	5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3'	ssRNA	Escherichia Coli (E. Coli)	C-terminal ribonuclease domain of Colicin E3	Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity.	N/A	12	Nitrocellulose Filter Binding Assay	4 ± 15 nM	Therapeutics	SELEX	5'-Radiolabelled (32P-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_0012	15023071	2004	In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA	F4-1	GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GACAUCUGUAAGUAAGAUUCUAUCUGCAAAGCGGUUAGGAGGGCUCGGACUCUGAUUGCCUCCCCGCACC-CAUAUGUGCGUCUACAUGGAUCCUCA	138	5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3'	ssRNA	Escherichia Coli (E. Coli)	C-terminal ribonuclease domain of Colicin E3	Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity.	N/A	12	Nitrocellulose Filter Binding Assay	7 ± 1 nM	Therapeutics	SELEX	5'-Radiolabelled (32P-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_0013	15023071	2004	In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA	F5-1	GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GUCAGCUGCUCGCGGGAUCGAUCCAUUCGGUGGCCAUGCUCCGGAAGAGGCUUCGCAAGACUCAGG-CAUAUGUGCGUCUACAUGGAUCCUCA	134	5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3'	ssRNA	Escherichia Coli (E. Coli)	C-terminal ribonuclease domain of Colicin E3	Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity.	N/A	12	Nitrocellulose Filter Binding Assay	10 ± 1 nM	Therapeutics	SELEX	5'-Radiolabelled (32P-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_0014	15023071	2004	In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA	F4-2	GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GACAUCUGUAAGUAAGAUUCUAUCUGCAAAGCGGUUAGGGGGGCUCGGACUCUGAUUGCCUCCCCGCACC-CAUAUGUGCGUCUACAUGGAUCCUCA	138	5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3'	ssRNA	Escherichia Coli (E. Coli)	C-terminal ribonuclease domain of Colicin E3	Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity.	N/A	12	Nitrocellulose Filter Binding Assay	294 ± 170 nM	Therapeutics	SELEX	5'-Radiolabelled (32P-labeled)	N/A	N/A	N/A	N/A	N/A