Target Organism : Vibrio Vulnificus

Total records found: 35

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0954	29051620	2017	Antimicrobial peptide-loaded gold nanoparticle-DNA aptamer conjugates as highly effective antibacterial therapeutics against Vibrio vulnificus	Apt(His)	GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC	40	N/A	ssDNA	Vibrio Vulnificus (MO6-24/O)	V. vulnificus-infected HeLa cells	The AuNP-AptHis conjugate delivers the HPA3P(His) peptide into host cells, inducing bacterial cell death by disrupting membrane integrity.	Compared with that of buffer- or AuNP-AptHis-incubated cells, the number of viable V. vulnificus cells in the AuNP-AptHis-HPA3PHis-treated cells decreased by 90% in 10 min. All infected mice injected with AuNP-AptHis-HPA3PHis survived until 120 h.	N/A	N/A	N/A	Targeted Delivery/Therapeutics	N/A	3'-Thiolated (A10-Thiol)	HPA3PHis and AuNP-Apt(His)-HPA3P(His) did not exhibit cytotoxicity against HeLa cells and mouse erythrocytes up to 10 µM.	N/A	N/A	N/A	N/A
ABdb_1108	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt1	AGGGTTGGTCGTCCAGCATTCCGTTCGATTGTAGTTCTGACTCTTGTGAAGTTAATGAGCTCCTTTTGCTGACTGTTGTT	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1109	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt2	TTCTGATGAGAGTTGCGACCTCCCGGATGAGTGCCCTGGCTCCGGGTTTGTCTATTTTTGGGGGTGTTGACAGATATCCT	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	Vapt2 could detect the pathogen in a wide concentration range: 8–2.0 × 10^8 cfu/ml.The Limit of Detection (LOD) was 8 cfu/ml.	13	Fluorescence Microscopy	26.8 ± 5.3 nM	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1110	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt3	ATCGGATATGAGGCCGGGTATTAAGTGGGGTTCCATATGCAAGGCAGATCTCCCAGTGTTTTTTCAGGATTGCGTTACTG	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1111	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt4	AAGAGGGCTTGGGAACTCTAGGCGTCTGTGCATTAAGCCATGTCTGCCGGGAAAGATCTGTGAAGTGTTCGCCCGCACTT	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1112	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt5	GCATGGGTATAGGGAAACCCGAGTCTAGTTTACACTGACGTTAGGAGATTACGTCTGCCGACAGAACATTCTCTCTGTGA	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1113	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt6	GGCGGGGTGTTATGAATCCACCGCGATCCGTTATGTTAGGCTGTAATCATTAAGCACTTTATGTGCACTCGTGGTATGCC	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1114	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt7	AATTACTGGAGCTTGGCCGTAGGTAGAAAGATTTGCATTATACCTGGGGGGCTCTCTGGTTGTGTTTAATTGGTTACCCC	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1115	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt8	ATGCTGCACTAGTTACCTTGCCTTTGCTTTCTTATTCTGCTCGTGCGTAAAAGTGGTTTTTCTTGCGTTGCGGGTGCTTG	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1116	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt9	TGTTCGTTCGACTTCTCCGTCGTTTTTGTATTAACGTAGACCTTGGTTGAGCATGCTTACCTCTGCTTGGATTAATGACG	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1117	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt10	TAAGGATCTTGGGTTCATGCCGCAACTGGGATGTTTGCTGCCTCCTTTATGGAGCTTAGCTGCGAGCGTTCTTGTTTGGT	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1118	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt11	GTCTAAGTGCTTCTAGGCGGATTTGGCGCGTTCCGACGATTAGACTAGGACAACGATTCAGTGGTGTCGATGGTGTGTTC	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1119	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt12	GGGGTAAGCCCGCGGCTCTCTCCTATGTATTCAGTGTACTCACGAAGATGTCCGTACTCCGTACGCTGCTATGCGTTCCC	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1120	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt13	TCGGGGGCGCAGCTTGGGCCGTTGCTCCTGCCGGTCTCTGTGTGCGTGCGGTTCTCGCTCTTGTGGCTCCGTCCTTGGGG	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1415	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V8	AGTATACGTATTACCTGCAGC-CAATCATGACCGCCCACCTCACTCG-GCAAGATCTCCGAGATATCG	66	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell (Cell wall protein)	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	The LOD of the V8 from cytometry is 29.96 CFU/mL, and the linear range is 102–5 × 105 CFU/mL.	13	Flow Cytometry	11.22 ± 1.30 nM	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	V8 and V13 can tolerate diluted serum as well as oyster infusion.	Best Candidate	N/A	N/A
ABdb_1416	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V9	AGTATACGTATTACCTGCAGC-CCTGGACATCATTGAGTACTCGTCT-GCAAGATCTCCGAGATATCG	66	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1417	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V11	AGTATACGTATTACCTGCAGC-TCCCAACCAATACCAGTACGTTGTA-GCAAGATCTCCGAGATATCG	66	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1418	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V12	AGTATACGTATTACCTGCAGC-TATGGATTTGCGTCATGTTTATGTG-GCAAGATCTCCGAGATATCG	66	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1419	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V13	AGTATACGTATTACCTGCAGC-CCAACCCTATGCTTCAACGGTCTTT-GCAAAGATCTCCGAGATATCG	67	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	15.47 ± 0.39 nM	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	V8 and V13 can tolerate diluted serum as well as oyster infusion.	Best Candidate	N/A	N/A
ABdb_1420	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V18	AGTATACGTATTACCTGCAGC-TGTGGGTGGGTGGGTGGTATCTGCA-GCAAGATCTCCGAGATATCG	66	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1421	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V20	AGTATACGTATTACCTGCAGC-CATCCCCTCTCCTGTTGCCCTGACA-GCAAAGATCTCCGAGATATCG	67	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1422	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V28	AGTATACGTATTACCTGCAGC-CCTGGACATCATTGAGTACTCGTCT-GCAAGATCTCCGAGATATCG	66	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1423	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V31	AGTATACGTATTACCTGCAGC-TGTGGGTGGGATTAGGTTCGGGTGG-GCAAGATCTCCGAGATATCG	66	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1424	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V38	AGTATACGTATTACCTGCAGC-CCAGACTTCAATCGCGTCAACCGTT-GCAAGATCTCCGAGATATCG	66	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1425	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V39	AGTATACGTATTACCTGCAGC-TGATGGTTGTATGACTGGATGTCAA-GCAAGATCTCCGAGATATCG	66	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1426	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V40	AGTATACGTATTACCTGCAGC-TCCCCTTTGCATGGCGGTGACACTG-GCAAGATCTCCGAGATATCG	66	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1427	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V41	AGTATACGTATTACCTGCAGC-CACCTAGAACACATTGCAACATTAG-GCAAGATCTCCGAGATATCG	66	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1428	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V44	AGTATACGTATTACCTGCAGC-TGCTCCTCGACTGTTGTTAATCGTG-GCAGATCTCCGAGATATCG	65	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1429	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V49	AGTATACGTATTACCTGCAGC-TGACATCGTCTGACCTCCACAAGCA-GCAAGATCTCCGAGATATCG	66	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1430	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V53	AGTATACGTATTACCTGCAGC-TGGGTCCGTATGTTGGTGTATGTGA-GCAAGATCTCCGAGATATCG	66	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1431	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V59	AGTATACGTATTACCTGCAGC-TGTATACCCGACCGTACCGACGTAA-GCAAGATCTCCGAGATATCG	66	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1432	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V69	AGTATACGTATTACCTGCAGC-TCACCTTCACACACTCCCTTCTTCG-GCAAGATCTCCGAGATATCG	66	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1433	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	V71	AGTATACGTATTACCTGCAGC-CCTGTACAAGCAGTATGTCAGCTGA-GCAAGATCTCCGAGATATCG	66	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	N/A	13	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1434	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	TV8	CAATCATGACCGCCCACCTCACTCG	25	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	The fluorescent intensity of V. vulnificus was significantly greater than that of other species.	13	Flow Cytometry	17.44 ± 1.30 nM	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1435	35493682	2020	Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology	TV13	CCAACCCTATGCTTCAACGGTCTTT	25	5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3'	ssDNA	Vibrio Vulnificus (ATCC 27562)	Whole cell	Isolate aptamers that specifically bind V. vulnificus across all culture phases.	The fluorescent intensity of V. vulnificus was significantly greater than that of other species.	13	Flow Cytometry	13.21 ± 2.19 nm	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A