Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 88
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0125 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A3P | ATAGGAGTCACGACGACCAGAA-TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | Showed a high binding affinity of 76% for V. parahemolyticus and a low apparent binding affinity of 4% for other bacteria. | 9 | Flow Cytometry | 16.88 ± 1.92 | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0126 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A1 | TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG | 40 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A1 was 64%. | 9 | Flow Cytometry | 22.92 ± 4.72 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0127 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A1P | ATAGGAGTCACGACGACCAGAA-TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A1P was 67%. | 9 | Flow Cytometry | 21.45 ± 2.62 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0128 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A3 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A3 was 75%. | 9 | Flow Cytometry | 24.03 ± 5.18 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0129 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A17P | ATAGGAGTCACGACGACCAGAA-AGGCCGGCCCCTCTGAACTAGATGCAGGGGAGGCGAGCGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0130 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A18P | ATAGGAGTCACGACGACCAGAA-GCGGGCAGCTCCACCGGTAGGCTCCGAGTCATCACGGTCG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A18P was 62%. | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0131 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A21P | ATAGGAGTCACGACGACCAGAA-TTTTGACGAAGTCAGTGCGTCGAAGCGCAAGCATTACAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0336 | 24267076 | 2013 | A dual-color flow cytometry protocol for the simultaneous detection of Vibrio parahaemolyticus and Salmonella typhimurium using aptamer conjugated quantum dots as labels | Apt1 | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer-modified QDs (QD-apt) were developed to selectively capture and simultaneously detect the target bacteria. | For V. parahaemolyticus cells, a linear range of 3.4 × 10(4) to 3.4 × 10(7) cfu/mL was obtained with QD 535-apt 1-FCM, and a detection limit of 5 × 10³ cfu/mL was achieved. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0431 | 24568625 | 2014 | Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels | Apt₂ | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers. | The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 10 cfu/mL for V. parahemolyticus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0434 | 24650583 | 2014 | A universal fluorescent aptasensor based on AccuBlue dye for the detection of pathogenic bacteria | VP-apt | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer is hybridized with complementary DNA (cDNA) to form fluorescent dsDNA. | Exhibit a linear concentration range of 50 to 10(6) cfu/mL, and the LOD was 35 cfu/mL in 1.5 h for V. parahaemolyticus. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0461 | https://doi.org/10.1007/s00604-014-1406-3 | 2014 | Simultaneous detection of pathogenic bacteria using an aptamer based biosensor and dual fluorescence resonance energy transfer from quantum dots to carbon nanoparticles. | Apt1 ( V. parahaemolyticus aptamer) | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Develop a dual fluorescence resonance energy transfer (FRET) from gQDs and rQDs and amorphous carbon nanoparticles (CNPs) for simultaneous detection of V. parahaemolyticus and S. typhimurium. | LOD: 25 cfu/mL and linear range from 50 to 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0692 | 26302256 | 2015 | Colorimetric Aptasensor Based on Enzyme for the Detection of Vibrio parahemolyticus | Apt 1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a colorimetric aptasensor system based on sandwich-type complex (AuNPs−HRP−aptamer−target−aptamer−MNPs) to detect V. parahemolyticus. | Linear detection range: 10 to 10^6 cfu/mL, with a limit of detection (LOD) of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0693 | 26302256 | 2015 | Colorimetric Aptasensor Based on Enzyme for the Detection of Vibrio parahemolyticus | Apt 2 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a colorimetric aptasensor system based on sandwich-type complex (AuNPs−HRP−aptamer−target−aptamer−MNPs) to detect V. parahemolyticus. | Linear detection range: 10 to 10^6 cfu/mL, with a limit of detection (LOD) of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0821 | https://doi.org/10.1016/j.foodcont.2015.11.031 | 2016 | Vibrio parahaemolyticus detection aptasensor using surface-enhanced Raman scattering | Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | A SERS-based aptasensor was developed using Au@Ag core-shell nanoparticles for the detection of V. parahaemolyticus. | Achieved a concentration in the linear range of 10–10(6) cfu/mL, with a limit of detection of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt 1) and 5'-Cyanine3 (Cy3) Labeled (for apt 2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0999 | https://doi.org/10.1007/s00604-017-2383-0 | 2017 | Rolling circle amplification based amperometric aptamer/immuno hybrid biosensor for ultrasensitive detection of Vibrio parahaemolyticus | Vp-aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed an antibody-aptamer-based hetero-sandwich amperometric biosensor for the detection of V. parahaemolyticus. | Achieved a range of 2.2 to 2.2 x10(8) cfu/mL, and the limit of detection is as low as 2 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | After 2 weeks of storage at 4°C, the fabricated electrochemical aptasensor retains about 95.2% of its initial sensing current response. | N/A | N/A | N/A |
| ABdb_1048 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-2 | TCAGCACGT-ATAAGCATGAATTGACCAACCTAAACTTATTCATTTTCCAGCACCTCTAATATTACTGGC-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | 75% binding affinity to V. parahaemolyticus than to other foodborne bacteria (less than 18%). | 8 | Flow Cytometry | 10.3 ± 4.5 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1049 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-1 | TCAGCACGT-AGCCCTATTTGTTTTCTCTTGTCTCTGTACTGCTGATGTTGGTCATTCTCTTTTCTCGGT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 19.2 ± 2.8 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1050 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-3 | TCAGCACGT-TATCTAGTCAGATATCCAGACAGTCGCGGCTGGAAGCTTCTGTTAAGAATTTGAGATACT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 25.2 ± 3.1 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1051 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-4 | TCAGCACGT-GCGGGCATTATTGCACTCCACGGCGAGTAGTGCTCACAGAGTCATTTACACCGGTCGTAT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 17.2 ± 5.1 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1151 | 29777309 | 2018 | Fluorometric determination of Vibrio parahaemolyticus using an F0F1-ATPase-based aptamer and labeled chromatophores | V. parahaemolyticus aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed an F0F1-ATPase-based aptasensor for the fluorometric determination of V. parahaemolyticus. | The relative fluorescence varies linearly over the 15 to 1.5 × 10(6) cfu/mL Vibrio parahaemolyticus concentration range, and the limit of detection is 15 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1152 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#1 | ATACCAGCTTATTCAATT-CCATGGTCCCTCGTGTTTATTATGTTGTCTGAACTGGCTG-AGATTGCACTTACTATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | VPCAapta#1 was significantly higher (798.41 ng/ul) than that of the other aptamer. | 11 | Surface Plasmon Resonance (SPR) | 2.04 ± 0.12 nM | Diagnostic | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1153 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#2 | ATACCAGCTTATTCAATT-CCACGTTTCCACGTATCCTCGGAGCTTGCTTAACCGTACG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1154 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#3 | ATACCAGCTTATTCAATT-TGCGTAGTTCTTTTAACAACCATTCAGCGTATTTTCGTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1155 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#4 | ATACCAGCTTATTCAATT-CCCTCGGCGTAACTAGTACCGTTGCACCACCAACGTGATT-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1156 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#5 | ATACCAGCTTATTCAATT-CGCAAGGGATTTCGGACCGGGCTTGGTCACACACAGAGCA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1157 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#6 | ATACCAGCTTATTCAATT-CCAGCAGTGGGGCATGGGGGAACGATAAGATTATAAGGGGG-AGATAGTAAGTGCAATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1158 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#7 | ATACCAGCTTATTCAATT-CACGCAAGCAGAAGCCACTCCCCCTGGTCGTACTATTTAG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1159 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#8 | ATACCAGCTTATTCAATT-CACAGGCGTACCACTGCCCCAACGATCCTTTTGGTTACCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1160 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#9 | ATACCAGCTTATTCAATT-GTCGGAGAGCCTGGCCGTCTGCTCGTAAGTACTATCATAGC-AGATAGTAAGTGCAATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1161 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#10 | ATACCAGCTTATTCAATT-TGGAGAAGCGGCAGTTGATGCCTGGTACCCGTCTGCTACG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1162 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#11 | ATACCAGCTTATTCAATT-CGTAAAGGACGCTGCCATGAATGTGCTATCCAAGCCTGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1163 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#12 | ATACCAGCTTATTCAATT-CGTAAAGAACGCTGCCATGAATGTGCTATCCAAGCCTGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1164 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#13 | ATACCAGCTTATTCAATT-CGTAAGAACGCTGCCATGAATGTGCTATCCAGGCCTGGG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1165 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#14 | ATACCAGCTTATTCAATT-CAACGGAGGGAAGTTTCCATGTCCGGTACCAAGCGGTTTTTG-AGATAGTAAGTGCAATCT | 78 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1166 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#15 | ATACCAGCTTATTCAATT-GCACGGGAGGCACCCTGACATTGCAAATCCCATCGGTGTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1167 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#16 | ATACCAGCTTATTCAATT-ACCTATAACAGCCATCATACGAGGTAATCCCCTCCCTCGA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1168 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#17 | ATACCAGCTTATTCAATT-CCAACTGGATCTTACTGAGGAACGGTCCATTAGCACATCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1169 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#18 | ATACCAGCTTATTCAATT-CGCGACCACATCCTGCGTAAACACATCTCCGCCAGTCCAT-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1170 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#19 | ATACCAGCTTATTCAATT-CGCAAGAGCAGCATACAGCACGAACGAGCCATTTACGCCA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1171 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#20 | ATACCAGCTTATTCAATT-CGAAGACCAGACATGGTAGCCACGCATAGTCCAACTTAAG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1172 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#21 | ATACCAGCTTATTCAATT-ACACCACACTAATGCATGCATTCTGTGAGTCACAGTTCA-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1173 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#22 | ATACCAGCTTATTCAATT-CACTCAAACCCAAACCATGCAAACTGAACAACGCAACACA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1174 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#23 | ATACCAGCTTATTCAATT-CACCAAACTGCCCAAATTTGAGGACGCCCTATACATGCG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1175 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#24 | ATACCAGCTTATTCAATT-GCCCAATACGTATGTTGATACATGCCCCTTACCCTTTGCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1176 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#25 | ATACCAGCTTATTCAATT-CACCGTAGTAAGTAAGCAGACGCTAAGGATGTTGCCAGTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1177 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#26 | ATACCAGCTTATTCAATT-GTGACATGAACTGGTTTTCCACAGCTTAGGATCATGGATG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1178 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#27 | ATACCAGCTTATTCAATT-GGGCATGTGGGCTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1179 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#28 | ATACCAGCTTATTCAATT-CCGTCGCTATAACCCTGTCTTTATATATCTTCGCCCACGGG-AGATAGTAAGTGCAATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1228 | 31183576 | 2019 | Surface-enhanced Raman spectroscopic single step detection of Vibrio parahaemolyticus using gold coated polydimethylsiloxane as the active substrate and aptamer modified gold nanoparticles | V.P. Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer-based SERS method using Au-PDMS film for the detection of V. parahaemolyticus. | The detection limit is 12 cfu/mL with a wide linear range from 1.2 × 10(2) to 1.2 × 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1255 | 30608683 | 2019 | Visualized Detection of Vibrio parahaemolyticus in Food Samples Using Dual-Functional Aptamers and Cut-Assisted Rolling Circle Amplification | A-Apt | TACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCAAAAAAAAAA | 71 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | A biosensor using Dual-Apt and cut-assisted rolling circle amplification (CA-RCA) for rapid and visualized detection of Vibrio parahaemolyticus. | Shows a good linear correlation in the range from 10(6) to 10 CFU/mL and LOD as low as 10 CFU/mL (g) in real food samples. | N/A | N/A | N/A | Biosensor | N/A | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1256 | 30608683 | 2019 | Visualized Detection of Vibrio parahaemolyticus in Food Samples Using Dual-Functional Aptamers and Cut-Assisted Rolling Circle Amplification | D-Apt | CCTCAGCATAAGCATGAATTGACCAACCTAAACTTATTCATTTTCCAGCACCTCTAATATTACTGGCGCAGTGCACCCACCCACCCACCC | 90 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | A biosensor using Dual-Apt and cut-assisted rolling circle amplification (CA-RCA) for rapid and visualized detection of Vibrio parahaemolyticus. | Shows a good linear correlation in the range from 10(6) to 10 CFU/mL and LOD as low as 10 CFU/mL (g) in real food samples. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate (3'-end phosphorylation) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1258 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A3P | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | Exhibits a wide linear detection range (from 10(2) to 10(7) cfu/mL), and the detection limit could be as low as 10 cfu/mL. | N/A | Flow Cytometry | 50.76 ± 8.92 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1259 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 32.53 ± 6.86 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1260 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A2 | GCAAAGAAACAGTGACTCGTTGA | 23 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 37.44 ± 6.98 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1261 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A3 | GCAACGAAACAGTGACTCGTTGA | 23 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 34.61 ± 3.47 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1262 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4 | CAACGAAACAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 28.65 ± 3.05 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled and 5'-Biotinylated (Biotin-TTTTTTTTT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1263 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A5 | AACGAAACAGTGACTCGTT | 19 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 422.0 ± 21.93 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1264 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A6 | ACGAAACAGTGACTCGT | 17 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 412.9 ± 27.12 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1265 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-1 | CAACGAAACATTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1004 ± 187.1 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1266 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-2 | CAACGAAACAGTTACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1103 ± 180.2 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1267 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-3 | CAACGAAACTGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 958.9 ± 183.1 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1268 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-4 | CAACGAAACAGCGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1070 ± 73.05 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1269 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-5 | CAACGAAACAGTGTCTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1119 ± 187.1 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1270 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-6 | CAACGAAATAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1070 ± 125.4 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1271 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-7 | CAACGAACCAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 423.2 ± 36.91 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1272 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-8 | CAACGATACAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 467.0 ± 33.38 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1273 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-9 | CAACGAAACAGTGAGTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 376.4 ± 54.25 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1384 | 32993865 | 2020 | A universal signal-on electrochemical assay for rapid on-site quantitation of vibrio parahaemolyticus using aptamer modified magnetic metal-organic framework and phenylboronic acid-ferrocene co-immobilized nanolabel | Aptamer | TTTTTTTTTCAACGAAACAGTGACTCGTTG | 30 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a signal-on type electrochemical aptasensor (Fe3O4@NMOF-Apt) to rapidly and on-site detect V.P. | Detects V.P in the range of 10–10(9) cfu/mL with an LOD of 3 cfu/mL and within only 20 min. | N/A | Linearized adsorption isotherm | 16.8 nM (with V.P.) and 2.2 ± 0.2 nM (with Fe3O4@NMOF-Apt) | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | No significant difference in the measured blank and signals was observed over 3 months with aptasensor, when 91.3% of the initial signal was obtained. | N/A | N/A | N/A |
| ABdb_1385 | 32905329 | 2020 | Simple Colorimetric Assay for Vibrio parahaemolyticus Detection Using Aptamer-Functionalized Nanoparticles | V.P. Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a visual colorimetric assay using aptamer-conjugated MNPs and AuNPs for the detection of V. parahaemolyticus. | Shows a linear range of 10-10(6) cfu/mL, with a limit of detection of 2.4 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1444 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.01 (ID 5) | TTTTTAAGCCCACAGACGWYCGGCAGGCACAGTYYGTCAAGGXCGYGCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | W = indole‐dU,Y = phenol‐dU,X = amine‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1445 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.02 (ID 6) | TTTTTAAGCCCACCYCGCYGTGCAAGGCGAACGCCATCAGTGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1446 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.03 (ID 7) | TTTTTAAGCCCACCYCCGWYCGAAGGCCACAGCYCATGCGCGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU,W = indole‐dU, five additional Ts at the 5'-end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1447 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.04 (ID 8) | TTTTTAACACGACCCCACYGTGCGAGCCGAACACCACCACGGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1448 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.05 (ID 9) | TTTTTAACACGACXYAGCYGTGWGGGCCGAACACCAGGCACGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | X = amine‐dU,Y = phenol‐dU, five additional Ts at the 5'‐end, and CCATG at the 3′‐end, five additional Ts at the 5′‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1449 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.06 (ID 12) | TTTTTAACACGACAGCAGWYCGGCGGGCACAGTGCGTGCGAGXCGYGCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | Aptamer ID 12 showed specific binding to Vp. | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | W = indole‐dU,Y = phenol‐dU,X = amine‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1450 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.07 (ID 13) | TTTTTAACACGACCAWACYGTGGCAGACGAACGCCGTCACAGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU,W = indole‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1451 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.08 (ID 14) | TTTTTAAGCCCACGCGGCYGTGAGXCGCACAGCCAWAGCACGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | W = indole‐dU,Y = phenol‐dU,X = amine‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1452 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.09 (ID 15) | GCCCACTGAACTGTGGCGGGCACAGGATGTGGAAGTGGGC | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1500 | 32000058 | 2020 | A SERS aptasensor for simultaneous multiple pathogens detection using gold decorated PDMS substrate | Apt 1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a SERS aptasensor using Apt-Au-PDMS film for simultaneous multiple-pathogen detection. | Can selectively detect 18 cfu/mL cells. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1557 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A1 | TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (CICC 21617) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1558 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A3 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (CICC 21617) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1559 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A18P | ATAGGAGTCACGACGACCAGAAGCGGGCAGCTCCACCGGTAGGCTCCGAGTCATCACGGTCGTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (CICC 21617) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1567 | 33780852 | 2021 | Microfluidic thread-based electrochemical aptasensor for rapid detection of Vibrio parahaemolyticus | Aptamer | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a thread-based microfluidic nano-aptasensor based on MoS2 modified threaded electrodes for V. parahaemolyticus detection. | The proposed aptasensor has a dynamic detection range of 10–10(6) CFU/mL, a detection limit of 5.74 CFU/mL, and an assay time of 30 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1569 | 33479797 | 2021 | A turn-on-type fluorescence resonance energy transfer aptasensor for vibrio detection using aptamer-modified polyhedral oligomeric silsesquioxane-perovskite quantum dots/Ti3C2 MXenes composite probes | VP aptamer | TTTTTTTTTCAACGAAACAGTGACTCGTTG | 30 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a turn-on–type aptasensor based on FRET pair using aptamer modified polyhedral oligomeric silsesquioxane-perovskite quantum dots (POSS-PQDs-Apt) as signal probe and titanium carbide (Ti3C2) MXenes as quencher for Vibrio parahaemolyticus (VP) determination. | Under optimized conditions, the assay can determine VP in the concentration range 10(2) - 10(6) cfu/mL with the detection limit (LOD) of 30 cfu/mL and 100 cfu/mL by naked eye in aquaculture water. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1579 | https://doi.org/10.1016/j.snb.2021.130337 | 2021 | Electrochemical aptasensor for simultaneous detection of foodborne pathogens based on a double stirring bars-assisted signal amplification strategy | Apt-V.P | TGGCTAGCTCAGTCATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTCCGCG | 60 | N/A | ssDNA | Vibrio Parahaemolyticus | Whole cell | Developed a double stirring bar-based signal-amplified strategy using aptamer-embedded tetrahedral DNA nanostructures for the simultaneous electrochemical detection of Vibrio parahaemolyticus (V.P) and Salmonella typhimurium (S.T). | Display a lower detection limit of 4 CFU/mL for V.P. within a detection range of 10–10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1582 | https://doi.org/10.1016/j.microc.2021.106132 | 2021 | A novel photoelectrochemical aptamer sensor based on rare-earth doped Bi2WO6 and Ag2S for the rapid detection of Vibrio parahaemolyticus | Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a novel photoelectrochemical aptasensor based on rare-earth doped Bi2WO6 and Ag2S for the detection of V. parahaemolyticus. | Showed a wide linear range from 3.2 × 10(2) CFU/mL to 3.2 × 10(8) CFU/mL, and a detection limit of 40 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | After 2 weeks of storage at 4°C in a refrigerator, the biosensor retained 95% of its initial response. | N/A | N/A | N/A |
| ABdb_1745 | https://doi.org/10.1016/j.snb.2021.130839 | 2022 | A dual-mode aptasensor for foodborne pathogens detection using Pt, phenylboric acid and ferrocene modified Ti3C2 MXenes nanoprobe | V.P-Apt | TTTTTTCACCCCACCTCGCTCCCGTGACACTAATGCTA | 38 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a dual-mode aptasensor based on electrochemical and colorimetric modes using PBA-Fc@Pt@MXenes nanoprobe for the detection of V.P in shrimps. | Showed a LOD and linear range of 5 CFU/mL and 10(1) to 10 (8) CFU/mL by electrochemical mode and 30 CFU/mL and 10(2) to 10 (8) CFU/mL by coulometric mode. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The electrochemical signal retained 89.6% of its original value after 2 weeks. | N/A | N/A | N/A |
| ABdb_1928 | 40916637 | 2025 | Study of Bacteriostasis of Kaempferide on Foodborne Pathogenic Bacteria by Indirect Determination of Capillary Electrophoresis | AP1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed an aptamer-based capillary sieving electrophoresis (CE)-Laser-induced fluorescence (LIF) detection of three bacteria, Vibrio parahaemolyticus, Escherichia coli, and Staphylococcus aureus. | The measured limit of detection (LOD) for V. parahaemolyticus was 3.70 × 10(6) CFU/mL and a linear range of 0.80-124 × 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |