Target Organism : Streptococcus Pyogenes

Total records found: 16

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0559	26678795	2015	An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes	E-CA 20	CACACACGGAACCCCGACAACATACATACGGTGAGGGTGG	40	N/A	ssDNA	Streptococcus Pyogenes M types	M proteins (M11)	Identify aptamers selective for S. pyogenes and some of its M-types.	Showed a 55% increase in the gated fluorescence intensities above background.	8	Flow Cytometry	7 ± 1 nM	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0560	26678795	2015	An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes	E-CA 20P	TTCACGGTAGCACGCATAGG-CACACACGGAACCCCGACAACATACATACGGTGAGGGTGG-CATCTGACCTCTGTGCTGCT	80	N/A	ssDNA	Streptococcus Pyogenes M types	M proteins (M11)	Identify aptamers selective for S. pyogenes and some of its M-types.	Showed a 61% increase in the gated fluorescence intensities above background.	8	Flow Cytometry	12 ± 1 nM	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0561	26678795	2015	An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes	D-Cells 9	GGGGAGGAGAAAAAGAGGACCAGAGTAACGATTCGTGGGG	40	N/A	ssDNA	Streptococcus Pyogenes M types	M proteins (M11)	Identify aptamers selective for S. pyogenes and some of its M-types.	Showed a 55% increase in the gated fluorescence intensities above background.	8	Flow Cytometry	71 ± 23 nM	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0562	26678795	2015	An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes	D-Cells 9P	TTCACGGTAGCACGCATAGG-GGGGAGGAGAAAAAGAGGACCAGAGTAACGATTCGTGGGG-CATCTGACCTCTGTGCTGCT	80	N/A	ssDNA	Streptococcus Pyogenes M types	M proteins (M11)	Identify aptamers selective for S. pyogenes and some of its M-types.	D-Cells 9P showed an increase in the gated fluorescence above background by 65%.	8	Flow Cytometry	44 ± 8 nM	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0563	26678795	2015	An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes	E-Cells 1P	TTCACGGTAGCACGCATAGG-GGGGAGGAGAAAAGAGGACCAGAGTAACGATTCGTGGGG-CATCTGACCTCTGTGCTGCT	79	N/A	ssDNA	Streptococcus Pyogenes M types	M proteins (M11)	Identify aptamers selective for S. pyogenes and some of its M-types.	N/A	8	Flow Cytometry	20 ± 3 nM	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0564	26678795	2015	An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes	E-Cells 1	GGGGAGGAGAAAAGAGGACCAGAGTAACGATTCGTGGGG	39	N/A	ssDNA	Streptococcus Pyogenes M types	M proteins (M11)	Identify aptamers selective for S. pyogenes and some of its M-types.	N/A	8	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0565	26678795	2015	An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes	D-Cells 20P	TTCACGGTAGCACGCATAGG-GGGGAGGAGAAATAGAGGACCAGAGTAACGATTCGTGGGG-CATCTGACCTCTGTGCTGCT	80	N/A	ssDNA	Streptococcus Pyogenes M types	M proteins (M11)	Identify aptamers selective for S. pyogenes and some of its M-types.	N/A	8	Flow Cytometry	N/A	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1029	29698672	2018	Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken	S-12	AGCAGCACAGAGGTCAGATG-GCGGGCGGGGGGAGGGCGGCCGTGGGCTGCGAGTGGGAGG-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Streptococcus Pyogenes (ATCC 49399)	Whole cell	Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken.	Limit of detection of 70 cfu/mL with a range of 70–7100 cfu/mL.	12	Flow Cytometry	44 ± 5 nM	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1030	29698672	2018	Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken	S-2	AGCAGCACAGAGGTCAGATG-GTTCGGGGTCGGGGTGAGTGGGGCCTAGGAGTGGGGGCGC-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Streptococcus Pyogenes (ATCC 49399)	Whole cell	Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken.	N/A	12	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1031	29698672	2018	Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken	S-8	AGCAGCACAGAGGTCAGATG-ATGGGGGGCGGGGAGGTGGGTACAGGGTCGGGGATGGCAG-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Streptococcus Pyogenes (ATCC 49399)	Whole cell	Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken.	N/A	12	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1032	29698672	2018	Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken	S-10	AGCAGCACAGAGGTCAGATG-CGGGCGGGGCGTGGGGTGTTGGAGTGGAGGGCGGGGCGGC-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Streptococcus Pyogenes (ATCC 49399)	Whole cell	Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken.	N/A	12	Flow Cytometry	54  ±  8 nM	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1033	29698672	2018	Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken	S-15	AGCAGCACAGAGGTCAGATG-CAGGGTGCGGGAGGGCCAAAGGGGGGAGGGCCCGGGGGGA-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Streptococcus Pyogenes (ATCC 49399)	Whole cell	Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken.	N/A	12	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1034	29698672	2018	Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken	S-21	AGCAGCACAGAGGTCAGATG-GGGGGAGGCGCCGGGCAGGGGGCTCGGGGGAGGCGGGCGG-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Streptococcus Pyogenes (ATCC 49399)	Whole cell	Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken.	N/A	12	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1035	29698672	2018	Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken	S-26	AGCAGCACAGAGGTCAGATG-TTCAGGGCGGGGTAAACGGGAGGTGGGGGGGGCTTGGGAC-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Streptococcus Pyogenes (ATCC 49399)	Whole cell	Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken.	N/A	12	Flow Cytometry	130  ±  24 nM	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1036	29698672	2018	Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken	S-28	AGCAGCACAGAGGTCAGATG-TAATACTACCAACTTCTTTGCCTGGCGTAAGTAACAGTCA-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Streptococcus Pyogenes (ATCC 49399)	Whole cell	Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken.	N/A	12	Flow Cytometry	132 ± 18 nM	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1037	29698672	2018	Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken	S-32	AGCAGCACAGAGGTCAGATG-TACACAATGCTTCGATAATTGACGCTACTTCATTTTATTA-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Streptococcus Pyogenes (ATCC 49399)	Whole cell	Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken.	N/A	12	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A